Regulon of RbsR in Vibrio fischeri ES114

Properties
Regulator type:	Transcription factor
TF locus tag:	VF_1449
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Vibrionales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Vibrionales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.4 Sequence: TTACGCAAACGTTTCGATGA Locus tag: VF_1444 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: VF_1445 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: VF_1446 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: VF_1447 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: VF_1448 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: VF_1449 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
	VF_1444	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	VF_1445	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	VF_1446	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	VF_1447	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	VF_1448	rbsK	Ribokinase (EC 2.7.1.15)
	VF_1449	rbsR	Transcriptional repressor of ribose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD