Regulog RbsR - Desulfovibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/delta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638	6	1
Desulfovibrio magneticus RS-1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028
Desulfohalobium retbaense DSM 5692

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
rbsD	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098	* Desulfovibrio salexigens DSM 2638 Site: position = -76 score = 4.4644 sequence = TTGCGCAAACGTTTCGATGA Gene: Desal_2553: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_2552: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_2551: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_2550: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_2549: Ribokinase (EC 2.7.1.15)	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	Ribokinase (EC 2.7.1.15)
rbsR	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_2548: Transcriptional repressor of ribose utilization, LacI family	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	Transcriptional repressor of ribose utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Desulfovibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --