Regulog RbsR - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 6 | 1 |
| Desulfovibrio magneticus RS-1 | ||
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfohalobium retbaense DSM 5692 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| rbsD |
|
|
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -76 score = 4.4644 sequence = TTGCGCAAACGTTTCGATGA Gene: Desal_2553: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
|
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
|
|
|
|
|
Gene: Desal_2552: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
|
|
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
|
|
|
|
|
Gene: Desal_2551: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
|
|
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
|
|
|
|
|
Gene: Desal_2550: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
|
|
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsK |
|
|
|
|
|
Gene: Desal_2549: Ribokinase (EC 2.7.1.15) |
|
|
|
|
Ribokinase (EC 2.7.1.15) |
| rbsR |
|
|
|
|
|
Gene: Desal_2548: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
|
Transcriptional repressor of ribose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |