Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rbsK gene

Properties
Regulog: RbsR - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/delta
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio salexigens DSM 2638
Position: -76
Score: 4.4644
Sequence: TTGCGCAAACGTTTCGATGA
Locus tag: Desal_2553
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Desal_2552
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Desal_2551
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Desal_2550
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: Desal_2549
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Desal_2548
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -76 4.5 TTGCGCAAACGTTTCGATGA Desal_2553