Profile of regulator RbsR in Desulfovibrionales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Regulog: | RbsR - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio salexigens DSM 2638 | |||||
| Desal_2553 | rbsD | -76 | 4.5 | TTGCGCAAACGTTTCGATGA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |