Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator RbsR in Desulfovibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio salexigens DSM 2638
Desal_2553 rbsD -76 4.5 TTGCGCAAACGTTTCGATGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise