Regulog KdgR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - KdgR
- By taxonomy - Pasteurellales
- By TF family - IclR
- By effector - 2-keto-3-deoxygluconate
- By pathway - Pectin and polygalacturonate utlization
| Genome | Genes | Operons |
|---|---|---|
| Haemophilus influenzae Rd KW20 | ||
| Aggregatibacter aphrophilus NJ8700 | ||
| Pasteurella multocida subsp. multocida str. Pm70 | ||
| Mannheimia succiniciproducens MBEL55E | 13 | 6 |
| Actinobacillus succinogenes 130Z | 13 | 6 |
| Haemophilus somnus 2336 | ||
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||
| Haemophilus ducreyi 35000HP | ||
| Haemophilus parasuis SH0165 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| togX |
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -99 score = 6.05124 sequence = AAATAAAACAATGTTTTAAAT Gene: MS1741: predicted oligogalacturonate transporter |
*
Actinobacillus succinogenes 130Z Site: position = -97 score = 5.82035 sequence = AAATAAAATTTTGTTTCAAAA Site: position = -102 score = 5.04863 sequence = ATTAAAAATAAAATTTTGTTT Gene: Asuc_1468: predicted oligogalacturonate transporter |
|
|
|
|
predicted oligogalacturonate transporter |
| ogl |
|
|
|
Gene: MS1740: Oligogalacturonate lyase (EC 4.2.2.6) |
Gene: Asuc_1467: Oligogalacturonate lyase (EC 4.2.2.6) |
|
|
|
|
Oligogalacturonate lyase (EC 4.2.2.6) |
| CRON 2. | ||||||||||
| pelX |
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -124 score = 4.82169 sequence = TAATAAAATAAAACATTATTT Site: position = -119 score = 6.05124 sequence = AAATAAAACATTATTTCAAAT Gene: MS1742: Exopolygalacturonate lyase (EC 4.2.2.9) |
*
Actinobacillus succinogenes 130Z Site: position = -73 score = 5.19626 sequence = AAATAAAATTGTGTTATATTA Site: position = -117 score = 5.79232 sequence = TATTAAAATAATGTTTCAAAA Gene: Asuc_1469: Exopolygalacturonate lyase (EC 4.2.2.9) |
|
|
|
|
Exopolygalacturonate lyase (EC 4.2.2.9) |
| CRON 3. | ||||||||||
| kduD |
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -88 score = 5.94981 sequence = AAATGAAATTATGTTTTATAT Gene: MS0563: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
*
Actinobacillus succinogenes 130Z Site: position = -122 score = 5.44366 sequence = AATTGAAATTGTATTTCAGAA Gene: Asuc_1474: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
|
|
|
|
2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125) |
| spiX |
|
|
|
Gene: MS0564: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
Gene: Asuc_1473: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
|
|
|
|
predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) |
| kdgK |
|
|
|
Gene: MS0565: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
Gene: Asuc_1472: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
|
|
|
|
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
| eda |
Gene: HI0047: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
Gene: NT05HA_0021: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
Gene: PM0947: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
Gene: MS0566: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
Gene: Asuc_1471: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
Gene: HSM_0408: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
|
|
|
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) |
| kdgF |
|
|
|
Gene: MS0567: Pectin degradation protein |
Gene: Asuc_1470: Pectin degradation protein |
|
|
|
|
Pectin degradation protein |
| CRON 4. | ||||||||||
| kdgR |
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -126 score = 5.94981 sequence = ATATAAAACATAATTTCATTT Gene: MS0562: 2-keto-3-deoxygluconate regulator, IclR family |
*
Actinobacillus succinogenes 130Z Site: position = -126 score = 5.44366 sequence = TTCTGAAATACAATTTCAATT Gene: Asuc_1475: 2-keto-3-deoxygluconate regulator, IclR family |
|
|
|
|
2-keto-3-deoxygluconate regulator, IclR family |
| CRON 5. | ||||||||||
| oglO |
|
Gene: NT05HA_0419: predicted oligogalacturonate-specific outer membrane porin |
2
Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0389: predicted oligogalacturonate-specific outer membrane porin Gene: PM0388: predicted oligogalacturonate-specific outer membrane porin |
*
Mannheimia succiniciproducens MBEL55E Site: position = -208 score = 5.05066 sequence = ATTAAAAATAAAATTTTAGAA Site: position = -170 score = 5.94633 sequence = TTTTAAAATATTGTTTTATTT Site: position = -107 score = 5.32864 sequence = ATTTGACATAGTGTTTCAATT Gene: MS0561: predicted oligogalacturonate-specific outer membrane porin |
*
Actinobacillus succinogenes 130Z Site: position = -148 score = 5.43415 sequence = TTTTAAAACCATATTTCAATT Gene: Asuc_1477: predicted oligogalacturonate-specific outer membrane porin |
|
|
|
|
predicted oligogalacturonate-specific outer membrane porin |
| CRON 6. | ||||||||||
| oglP |
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -155 score = 6.12521 sequence = AATTAAAATAATGTTTTATTT Gene: MS0698: predicted oligogalacturonate TRAP transporter, substrate-binding subunit |
*
Actinobacillus succinogenes 130Z Site: position = -153 score = 5.54167 sequence = ATTCAAAACATAATTTCATTT Gene: Asuc_1923: predicted oligogalacturonate TRAP transporter, substrate-binding subunit |
|
|
|
|
predicted oligogalacturonate TRAP transporter, substrate-binding subunit |
| oglQ |
|
|
|
Gene: MS0697: predicted oligogalacturonate TRAP transporter, small transmembrane subunit |
Gene: Asuc_1922: predicted oligogalacturonate TRAP transporter, small transmembrane subunit |
|
|
|
|
predicted oligogalacturonate TRAP transporter, small transmembrane subunit |
| oglM |
|
|
|
Gene: MS0696: predicted oligogalacturonate TRAP transporter, large transmembrane subunit |
Gene: Asuc_1921: predicted oligogalacturonate TRAP transporter, large transmembrane subunit |
|
|
|
|
predicted oligogalacturonate TRAP transporter, large transmembrane subunit |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |