Regulog HutC - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - HutC
- By TF family - GntR/Others
- By effector - cis-Urocanic acid
- By pathway - Histidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 11 | 2 |
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | 8 | 4 |
| Delftia acidovorans SPH-1 | 13 | 3 |
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | 27 | 6 |
| Rhodoferax ferrireducens DSM 15236 | 8 | 1 |
| Variovorax paradoxus S110 | 13 | 2 |
| Verminephrobacter eiseniae EF01-2 | 10 | 1 |
| Methylibium petroleiphilum PM1 | ||
| Leptothrix cholodnii SP-6 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| hisT |
|
|
|
*
Delftia acidovorans SPH-1 Site: position = -449 score = 5.15069 sequence = CATATTGTATATACAGGCTT Gene: Daci_0094: Histidine transport protein (permease) |
|
|
|
|
|
|
|
Histidine transport protein (permease) |
| CRON 2. | ||||||||||||
| COG1732 (OpuBC) |
|
|
|
|
|
*
Polaromonas sp. JS666 Site: position = -158 score = 5.26867 sequence = TCGCTTGTATATACAAGTTG Gene: Bpro_1158: ABC proline/glycine/betaine transporter, periplasmic binding domain |
|
|
|
|
|
ABC proline/glycine/betaine transporter, periplasmic binding domain |
| hutH2 |
|
|
|
|
|
Gene: Bpro_1157: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
|
|
Histidine ammonia-lyase (EC 4.3.1.3) |
| COG1174 (OpuBB) |
|
|
|
|
|
2
Polaromonas sp. JS666 Gene: Bpro_1155: ABC proline/glycine/betaine transporter, permease component Gene: Bpro_1156: ABC proline/glycine/betaine transporter, permease component |
|
|
|
|
|
ABC proline/glycine/betaine transporter, permease component |
| COG1125 (OpuBA) |
|
|
|
|
|
Gene: Bpro_1154: ABC proline/glycine/betaine transporter, ATPase component |
|
|
|
|
|
ABC proline/glycine/betaine transporter, ATPase component |
| CRON 3. | ||||||||||||
| hutC |
|
|
*
Comamonas testosteroni KF-1 Site: position = -80 score = 4.88486 sequence = AAAGTTGTCTATACGAATTT Gene: CtesDRAFT_4040: Histidine utilization repressor, GntR family |
|
|
|
|
|
|
|
|
Histidine utilization repressor, GntR family |
| CRON 4. | ||||||||||||
| hisX |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -85 score = 5.09304 sequence = AACCCTGTATAGACAGCATG Gene: Aave_2969: Putative histidine ABC transporter, periplasmic substrate-binding protein |
|
*
Comamonas testosteroni KF-1 Site: position = -117 score = 5.13435 sequence = AAGCCTGTATATACATGTTC Site: position = -164 score = 4.45239 sequence = ATGCATGTCTATACAGCTGT Gene: CtesDRAFT_4035: Putative histidine ABC transporter, periplasmic substrate-binding protein |
*
Delftia acidovorans SPH-1 Site: position = -217 score = 5.01887 sequence = CAGGTTGTATGGACAAGCTT Site: position = -115 score = 5.11005 sequence = AATCCTGTATATACATGTCC Gene: Daci_0145: Putative histidine ABC transporter, periplasmic substrate-binding protein |
|
*
Polaromonas sp. JS666 Site: position = -109 score = 5.44403 sequence = TTACCTGTATATACAGGTTG Site: position = -231 score = 4.72002 sequence = ATACCTGTATAGACAGCGCA Gene: Bpro_1047: Putative histidine ABC transporter, periplasmic substrate-binding protein |
|
*
Variovorax paradoxus S110 Site: position = -176 score = 5.06279 sequence = CTTCCTGTATAGACAGCAAT Site: position = -110 score = 5.69602 sequence = TATCCTGTATATACAAGTTG Gene: Vapar_0154: Putative histidine ABC transporter, periplasmic substrate-binding protein |
*
Verminephrobacter eiseniae EF01-2 Site: position = -100 score = 5.35556 sequence = CAACCTGTATAGACAGGAAT Gene: Veis_3641: Putative histidine ABC transporter, periplasmic substrate-binding protein |
|
|
Putative histidine ABC transporter, periplasmic substrate-binding protein |
| hisY |
Gene: Aave_2968: Putative histidine ABC transporter, permease protein |
|
Gene: CtesDRAFT_4036: Putative histidine ABC transporter, permease protein |
Gene: Daci_0146: Putative histidine ABC transporter, permease protein |
|
Gene: Bpro_1046: Putative histidine ABC transporter, permease protein |
|
Gene: Vapar_0155: Putative histidine ABC transporter, permease protein |
Gene: Veis_3642: Putative histidine ABC transporter, permease protein |
|
|
Putative histidine ABC transporter, permease protein |
| hisZ |
Gene: Aave_2967: Putative histidine ABC transporter, ATP-binding protein |
|
Gene: CtesDRAFT_4037: Putative histidine ABC transporter, ATP-binding protein |
Gene: Daci_0147: Putative histidine ABC transporter, ATP-binding protein |
|
Gene: Bpro_1045: Putative histidine ABC transporter, ATP-binding protein |
|
Gene: Vapar_0156: Putative histidine ABC transporter, ATP-binding protein |
Gene: Veis_3643: Putative histidine ABC transporter, ATP-binding protein |
|
|
Putative histidine ABC transporter, ATP-binding protein |
| hutC |
Gene: Aave_2966: Histidine utilization repressor, GntR family |
|
Gene: CtesDRAFT_4038: Histidine utilization repressor, GntR family |
Gene: Daci_0148: Histidine utilization repressor, GntR family |
|
*2
Polaromonas sp. JS666 Gene: Bpro_1044: Histidine utilization repressor, GntR family Site: position = -98 score = 5.70955 sequence = GTAGTTGTCTATACAACTTG Gene: Bpro_1165: Histidine utilization repressor, GntR family |
Gene: Rfer_4157: Histidine utilization repressor, GntR family |
Gene: Vapar_0157: Histidine utilization repressor, GntR family |
Gene: Veis_3644: Histidine utilization repressor, GntR family |
|
|
Histidine utilization repressor, GntR family |
| hutH |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -24 score = 5.2384 sequence = TGACTTGTATATACAGGAAA Site: position = -102 score = 5.63605 sequence = CAGCCTGTATATACAAGTTG Gene: Aave_2965: Histidine ammonia-lyase (EC 4.3.1.3) |
|
*
Comamonas testosteroni KF-1 Site: position = -24 score = 4.55643 sequence = TTGACTGTATAGACAGGTAT Gene: CtesDRAFT_4039: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Delftia acidovorans SPH-1 Site: position = -67 score = 4.86688 sequence = GATATTGTATAGACAGGCAT Gene: Daci_0149: Histidine ammonia-lyase (EC 4.3.1.3) |
|
*2
Polaromonas sp. JS666 Site: position = -25 score = 5.57679 sequence = CAACTTGTATATACAGGACT Gene: Bpro_1043: Histidine ammonia-lyase (EC 4.3.1.3) Gene: Bpro_1160: Histidine ammonia-lyase (EC 4.3.1.3) |
|
*
Variovorax paradoxus S110 Site: position = -22 score = 5.57762 sequence = CTACTTGTATAGACAGGTTC Gene: Vapar_0158: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Veis_3645: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
Histidine ammonia-lyase (EC 4.3.1.3) |
| hutU |
Gene: Aave_2964: Urocanate hydratase (EC 4.2.1.49) |
|
Gene: CtesDRAFT_4042: Urocanate hydratase (EC 4.2.1.49) |
Gene: Daci_0150: Urocanate hydratase (EC 4.2.1.49) |
|
*2
Polaromonas sp. JS666 Gene: Bpro_1042: Urocanate hydratase (EC 4.2.1.49) Site: position = -99 score = 5.70955 sequence = CAAGTTGTATAGACAACTAC Gene: Bpro_1164: Urocanate hydratase (EC 4.2.1.49) |
|
Gene: Vapar_0159: Urocanate hydratase (EC 4.2.1.49) |
Gene: Veis_3646: Urocanate hydratase (EC 4.2.1.49) |
|
|
Urocanate hydratase (EC 4.2.1.49) |
| hutD |
Gene: Aave_2962: Conserved hypothetical protein related to histidine degradation |
|
Gene: CtesDRAFT_4043: Conserved hypothetical protein related to histidine degradation |
Gene: Daci_0151: Conserved hypothetical protein related to histidine degradation |
|
Gene: Bpro_1036: Conserved hypothetical protein related to histidine degradation |
Gene: Rfer_4156: Conserved hypothetical protein related to histidine degradation |
Gene: Vapar_0163: Conserved hypothetical protein related to histidine degradation |
Gene: Veis_3647: Conserved hypothetical protein related to histidine degradation |
|
Gene: Lcho_0164: Conserved hypothetical protein related to histidine degradation |
Conserved hypothetical protein related to histidine degradation |
| hutI |
Gene: Aave_2961: Imidazolonepropionase (EC 3.5.2.7) |
|
Gene: CtesDRAFT_4044: Imidazolonepropionase (EC 3.5.2.7) |
Gene: Daci_0152: Imidazolonepropionase (EC 3.5.2.7) |
|
Gene: Bpro_1035: Imidazolonepropionase (EC 3.5.2.7) |
|
Gene: Vapar_0164: Imidazolonepropionase (EC 3.5.2.7) |
Gene: Veis_3648: Imidazolonepropionase (EC 3.5.2.7) |
|
|
Imidazolonepropionase (EC 3.5.2.7) |
| hutF |
Gene: Aave_2960: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
|
Gene: CtesDRAFT_4047: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Daci_0155: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
|
Gene: Bpro_1034: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Rfer_4154: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Vapar_0165: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Veis_3649: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
|
|
Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
| hutG |
Gene: Aave_2959: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Ajs_1666: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: CtesDRAFT_4204: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Daci_0156: N-formylglutamate deformylase (EC 3.5.1.68) |
|
Gene: Bpro_1166: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Rfer_4155: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Vapar_0166: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Veis_3650: N-formylglutamate deformylase (EC 3.5.1.68) |
|
|
N-formylglutamate deformylase (EC 3.5.1.68) |
| COG1414 |
|
|
Gene: CtesDRAFT_1440: Transcriptional regulator, IclR family |
|
|
Gene: Bpro_1041: Transcriptional regulator, IclR family |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -221 score = 5.82782 sequence = AAAGTTGTCTATACAACTTA Gene: Rfer_4161: Transcriptional regulator, IclR family |
Gene: Vapar_0160: Transcriptional regulator, IclR family |
|
|
|
Transcriptional regulator, IclR family |
| COG834 (HisJ) |
|
|
|
|
|
Gene: Bpro_1040: ABC amino acid transporter, periplasmic binding protein |
Gene: Rfer_4160: ABC amino acid transporter, periplasmic binding protein |
Gene: Vapar_0161: ABC amino acid transporter, periplasmic binding protein |
Gene: Veis_3016: ABC amino acid transporter, periplasmic binding protein |
|
|
ABC amino acid transporter, periplasmic binding protein |
| COG765 (HisM) |
|
|
|
|
|
Gene: Bpro_1039: ABC amino acid transporter, permease component |
Gene: Rfer_4159: ABC amino acid transporter, permease component |
Gene: Vapar_0162: ABC amino acid transporter, permease component |
Gene: Veis_3015: ABC amino acid transporter, permease component |
|
|
ABC amino acid transporter, permease component |
| COG1126 (GlnQ) |
|
|
|
|
|
Gene: Bpro_1038: ABC amino acid transporter, ATPase component |
Gene: Rfer_4158: ABC amino acid transporter, ATPase component |
|
Gene: Veis_3014: ABC amino acid transporter, ATPase component |
|
|
ABC amino acid transporter, ATPase component |
| COG5285 |
Gene: Aave_2963: Phytanoyl-CoA dioxygenase |
|
|
|
|
Gene: Bpro_1037: Phytanoyl-CoA dioxygenase |
|
|
|
|
|
Phytanoyl-CoA dioxygenase |
| COG277 (GlcD) |
|
|
Gene: CtesDRAFT_4045: FAD linked oxidase domain protein |
Gene: Daci_0153: FAD linked oxidase domain protein |
|
|
|
|
|
|
|
FAD linked oxidase domain protein |
| hisC |
|
|
Gene: CtesDRAFT_4046: Histidinol-phosphate aminotransferase |
Gene: Daci_0154: Histidinol-phosphate aminotransferase |
|
|
|
|
|
|
|
Histidinol-phosphate aminotransferase |
| COG2423 |
|
|
|
|
|
2
Polaromonas sp. JS666 Gene: Bpro_5200: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12) Gene: Bpro_1163: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12) |
|
|
|
|
|
Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12) |
| COG3221 (PhnD) |
|
|
|
|
|
Gene: Bpro_1162: ABC phosphate/phosphonate transporter, periplasmic binding component |
|
|
|
|
|
ABC phosphate/phosphonate transporter, periplasmic binding component |
| COG3181 |
|
|
|
|
|
Gene: Bpro_1161: Uncharacterized conserved putative exported protein |
|
|
|
|
|
Uncharacterized conserved putative exported protein |
| COG1457 (CodB) |
|
|
*
Comamonas testosteroni KF-1 Site: position = -85 score = 4.88486 sequence = AAATTCGTATAGACAACTTT Gene: CtesDRAFT_4041: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
|
|
|
|
|
|
|
|
Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
| CRON 5. | ||||||||||||
| COG2855 |
Gene: Aave_4024: Predicted membrane protein |
|
|
|
|
*
Polaromonas sp. JS666 Site: position = -120 score = 5.26867 sequence = CAACTTGTATATACAAGCGA Gene: Bpro_1159: Predicted membrane protein |
|
|
|
|
|
Predicted membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |