Statistics of regulated genes

Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1	11	2
Acidovorax sp. JS42
Comamonas testosteroni KF-1	8	4
Delftia acidovorans SPH-1	13	3
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666	27	6
Rhodoferax ferrireducens DSM 15236	8	1
Variovorax paradoxus S110	13	2
Verminephrobacter eiseniae EF01-2	10	1
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes												Function
CRON 1.
hisT	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	* Delftia acidovorans SPH-1 Site: position = -449 score = 5.15069 sequence = CATATTGTATATACAGGCTT Gene: Daci_0094: Histidine transport protein (permease)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Histidine transport protein (permease)
CRON 2.
COG1732 (OpuBC)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -158 score = 5.26867 sequence = TCGCTTGTATATACAAGTTG Gene: Bpro_1158: ABC proline/glycine/betaine transporter, periplasmic binding domain	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	ABC proline/glycine/betaine transporter, periplasmic binding domain
hutH2	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1157: Histidine ammonia-lyase (EC 4.3.1.3)	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Histidine ammonia-lyase (EC 4.3.1.3)
COG1174 (OpuBB)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	2 Polaromonas sp. JS666 Gene: Bpro_1155: ABC proline/glycine/betaine transporter, permease component Gene: Bpro_1156: ABC proline/glycine/betaine transporter, permease component	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	ABC proline/glycine/betaine transporter, permease component
COG1125 (OpuBA)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1154: ABC proline/glycine/betaine transporter, ATPase component	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	ABC proline/glycine/betaine transporter, ATPase component
CRON 3.
hutC	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	* Comamonas testosteroni KF-1 Site: position = -80 score = 4.88486 sequence = AAAGTTGTCTATACGAATTT Gene: CtesDRAFT_4040: Histidine utilization repressor, GntR family	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Histidine utilization repressor, GntR family
CRON 4.
hisX	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -85 score = 5.09304 sequence = AACCCTGTATAGACAGCATG Gene: Aave_2969: Putative histidine ABC transporter, periplasmic substrate-binding protein	Acidovorax sp. JS42	* Comamonas testosteroni KF-1 Site: position = -117 score = 5.13435 sequence = AAGCCTGTATATACATGTTC Site: position = -164 score = 4.45239 sequence = ATGCATGTCTATACAGCTGT Gene: CtesDRAFT_4035: Putative histidine ABC transporter, periplasmic substrate-binding protein	* Delftia acidovorans SPH-1 Site: position = -217 score = 5.01887 sequence = CAGGTTGTATGGACAAGCTT Site: position = -115 score = 5.11005 sequence = AATCCTGTATATACATGTCC Gene: Daci_0145: Putative histidine ABC transporter, periplasmic substrate-binding protein	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -109 score = 5.44403 sequence = TTACCTGTATATACAGGTTG Site: position = -231 score = 4.72002 sequence = ATACCTGTATAGACAGCGCA Gene: Bpro_1047: Putative histidine ABC transporter, periplasmic substrate-binding protein	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -176 score = 5.06279 sequence = CTTCCTGTATAGACAGCAAT Site: position = -110 score = 5.69602 sequence = TATCCTGTATATACAAGTTG Gene: Vapar_0154: Putative histidine ABC transporter, periplasmic substrate-binding protein	* Verminephrobacter eiseniae EF01-2 Site: position = -100 score = 5.35556 sequence = CAACCTGTATAGACAGGAAT Gene: Veis_3641: Putative histidine ABC transporter, periplasmic substrate-binding protein	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Putative histidine ABC transporter, periplasmic substrate-binding protein
hisY	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2968: Putative histidine ABC transporter, permease protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4036: Putative histidine ABC transporter, permease protein	Delftia acidovorans SPH-1 Gene: Daci_0146: Putative histidine ABC transporter, permease protein	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1046: Putative histidine ABC transporter, permease protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_0155: Putative histidine ABC transporter, permease protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_3642: Putative histidine ABC transporter, permease protein	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Putative histidine ABC transporter, permease protein
hisZ	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2967: Putative histidine ABC transporter, ATP-binding protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4037: Putative histidine ABC transporter, ATP-binding protein	Delftia acidovorans SPH-1 Gene: Daci_0147: Putative histidine ABC transporter, ATP-binding protein	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1045: Putative histidine ABC transporter, ATP-binding protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_0156: Putative histidine ABC transporter, ATP-binding protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_3643: Putative histidine ABC transporter, ATP-binding protein	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Putative histidine ABC transporter, ATP-binding protein
hutC	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2966: Histidine utilization repressor, GntR family	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4038: Histidine utilization repressor, GntR family	Delftia acidovorans SPH-1 Gene: Daci_0148: Histidine utilization repressor, GntR family	Polaromonas naphthalenivorans CJ2	*2 Polaromonas sp. JS666 Gene: Bpro_1044: Histidine utilization repressor, GntR family Site: position = -98 score = 5.70955 sequence = GTAGTTGTCTATACAACTTG Gene: Bpro_1165: Histidine utilization repressor, GntR family	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4157: Histidine utilization repressor, GntR family	Variovorax paradoxus S110 Gene: Vapar_0157: Histidine utilization repressor, GntR family	Verminephrobacter eiseniae EF01-2 Gene: Veis_3644: Histidine utilization repressor, GntR family	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Histidine utilization repressor, GntR family
hutH	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -24 score = 5.2384 sequence = TGACTTGTATATACAGGAAA Site: position = -102 score = 5.63605 sequence = CAGCCTGTATATACAAGTTG Gene: Aave_2965: Histidine ammonia-lyase (EC 4.3.1.3)	Acidovorax sp. JS42	* Comamonas testosteroni KF-1 Site: position = -24 score = 4.55643 sequence = TTGACTGTATAGACAGGTAT Gene: CtesDRAFT_4039: Histidine ammonia-lyase (EC 4.3.1.3)	* Delftia acidovorans SPH-1 Site: position = -67 score = 4.86688 sequence = GATATTGTATAGACAGGCAT Gene: Daci_0149: Histidine ammonia-lyase (EC 4.3.1.3)	Polaromonas naphthalenivorans CJ2	*2 Polaromonas sp. JS666 Site: position = -25 score = 5.57679 sequence = CAACTTGTATATACAGGACT Gene: Bpro_1043: Histidine ammonia-lyase (EC 4.3.1.3) Gene: Bpro_1160: Histidine ammonia-lyase (EC 4.3.1.3)	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -22 score = 5.57762 sequence = CTACTTGTATAGACAGGTTC Gene: Vapar_0158: Histidine ammonia-lyase (EC 4.3.1.3)	Verminephrobacter eiseniae EF01-2 Gene: Veis_3645: Histidine ammonia-lyase (EC 4.3.1.3)	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Histidine ammonia-lyase (EC 4.3.1.3)
hutU	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2964: Urocanate hydratase (EC 4.2.1.49)	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4042: Urocanate hydratase (EC 4.2.1.49)	Delftia acidovorans SPH-1 Gene: Daci_0150: Urocanate hydratase (EC 4.2.1.49)	Polaromonas naphthalenivorans CJ2	*2 Polaromonas sp. JS666 Gene: Bpro_1042: Urocanate hydratase (EC 4.2.1.49) Site: position = -99 score = 5.70955 sequence = CAAGTTGTATAGACAACTAC Gene: Bpro_1164: Urocanate hydratase (EC 4.2.1.49)	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_0159: Urocanate hydratase (EC 4.2.1.49)	Verminephrobacter eiseniae EF01-2 Gene: Veis_3646: Urocanate hydratase (EC 4.2.1.49)	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Urocanate hydratase (EC 4.2.1.49)
hutD	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2962: Conserved hypothetical protein related to histidine degradation	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4043: Conserved hypothetical protein related to histidine degradation	Delftia acidovorans SPH-1 Gene: Daci_0151: Conserved hypothetical protein related to histidine degradation	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1036: Conserved hypothetical protein related to histidine degradation	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4156: Conserved hypothetical protein related to histidine degradation	Variovorax paradoxus S110 Gene: Vapar_0163: Conserved hypothetical protein related to histidine degradation	Verminephrobacter eiseniae EF01-2 Gene: Veis_3647: Conserved hypothetical protein related to histidine degradation	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6 Gene: Lcho_0164: Conserved hypothetical protein related to histidine degradation	Conserved hypothetical protein related to histidine degradation
hutI	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2961: Imidazolonepropionase (EC 3.5.2.7)	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4044: Imidazolonepropionase (EC 3.5.2.7)	Delftia acidovorans SPH-1 Gene: Daci_0152: Imidazolonepropionase (EC 3.5.2.7)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1035: Imidazolonepropionase (EC 3.5.2.7)	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_0164: Imidazolonepropionase (EC 3.5.2.7)	Verminephrobacter eiseniae EF01-2 Gene: Veis_3648: Imidazolonepropionase (EC 3.5.2.7)	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Imidazolonepropionase (EC 3.5.2.7)
hutF	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2960: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4047: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Delftia acidovorans SPH-1 Gene: Daci_0155: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1034: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4154: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Variovorax paradoxus S110 Gene: Vapar_0165: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Verminephrobacter eiseniae EF01-2 Gene: Veis_3649: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutG	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2959: N-formylglutamate deformylase (EC 3.5.1.68)	Acidovorax sp. JS42 Gene: Ajs_1666: N-formylglutamate deformylase (EC 3.5.1.68)	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4204: N-formylglutamate deformylase (EC 3.5.1.68)	Delftia acidovorans SPH-1 Gene: Daci_0156: N-formylglutamate deformylase (EC 3.5.1.68)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1166: N-formylglutamate deformylase (EC 3.5.1.68)	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4155: N-formylglutamate deformylase (EC 3.5.1.68)	Variovorax paradoxus S110 Gene: Vapar_0166: N-formylglutamate deformylase (EC 3.5.1.68)	Verminephrobacter eiseniae EF01-2 Gene: Veis_3650: N-formylglutamate deformylase (EC 3.5.1.68)	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	N-formylglutamate deformylase (EC 3.5.1.68)
COG1414	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1440: Transcriptional regulator, IclR family	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1041: Transcriptional regulator, IclR family	* Rhodoferax ferrireducens DSM 15236 Site: position = -221 score = 5.82782 sequence = AAAGTTGTCTATACAACTTA Gene: Rfer_4161: Transcriptional regulator, IclR family	Variovorax paradoxus S110 Gene: Vapar_0160: Transcriptional regulator, IclR family	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Transcriptional regulator, IclR family
COG834 (HisJ)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1040: ABC amino acid transporter, periplasmic binding protein	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4160: ABC amino acid transporter, periplasmic binding protein	Variovorax paradoxus S110 Gene: Vapar_0161: ABC amino acid transporter, periplasmic binding protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_3016: ABC amino acid transporter, periplasmic binding protein	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	ABC amino acid transporter, periplasmic binding protein
COG765 (HisM)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1039: ABC amino acid transporter, permease component	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4159: ABC amino acid transporter, permease component	Variovorax paradoxus S110 Gene: Vapar_0162: ABC amino acid transporter, permease component	Verminephrobacter eiseniae EF01-2 Gene: Veis_3015: ABC amino acid transporter, permease component	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	ABC amino acid transporter, permease component
COG1126 (GlnQ)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1038: ABC amino acid transporter, ATPase component	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4158: ABC amino acid transporter, ATPase component	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_3014: ABC amino acid transporter, ATPase component	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	ABC amino acid transporter, ATPase component
COG5285	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2963: Phytanoyl-CoA dioxygenase	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1037: Phytanoyl-CoA dioxygenase	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Phytanoyl-CoA dioxygenase
COG277 (GlcD)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4045: FAD linked oxidase domain protein	Delftia acidovorans SPH-1 Gene: Daci_0153: FAD linked oxidase domain protein	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	FAD linked oxidase domain protein
hisC	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_4046: Histidinol-phosphate aminotransferase	Delftia acidovorans SPH-1 Gene: Daci_0154: Histidinol-phosphate aminotransferase	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Histidinol-phosphate aminotransferase
COG2423	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	2 Polaromonas sp. JS666 Gene: Bpro_5200: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12) Gene: Bpro_1163: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
COG3221 (PhnD)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1162: ABC phosphate/phosphonate transporter, periplasmic binding component	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	ABC phosphate/phosphonate transporter, periplasmic binding component
COG3181	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1161: Uncharacterized conserved putative exported protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Uncharacterized conserved putative exported protein
COG1457 (CodB)	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	* Comamonas testosteroni KF-1 Site: position = -85 score = 4.88486 sequence = AAATTCGTATAGACAACTTT Gene: CtesDRAFT_4041: Permease, cytosine/purines, uracil, thiamine, allantoin family protein	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Permease, cytosine/purines, uracil, thiamine, allantoin family protein
CRON 5.
COG2855	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_4024: Predicted membrane protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -120 score = 5.26867 sequence = CAACTTGTATATACAAGCGA Gene: Bpro_1159: Predicted membrane protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Predicted membrane protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD