Regulon of HutC in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_0148
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Comamonadaceae
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 4.9 Sequence: GATATTGTATAGACAGGCAT Locus tag: Daci_0149 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Daci_0150 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: Daci_0151 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: Daci_0152 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: Daci_0153 Name: COG277 (GlcD) Funciton: FAD linked oxidase domain protein Locus tag: Daci_0154 Name: hisC Funciton: Histidinol-phosphate aminotransferase Locus tag: Daci_0155 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) Locus tag: Daci_0156 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	Daci_0149	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	Daci_0150	hutU	Urocanate hydratase (EC 4.2.1.49)
	Daci_0151	hutD	Conserved hypothetical protein related to histidine degradation
	Daci_0152	hutI	Imidazolonepropionase (EC 3.5.2.7)
	Daci_0153	COG277 (GlcD)	FAD linked oxidase domain protein
	Daci_0154	hisC	Histidinol-phosphate aminotransferase
	Daci_0155	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	Daci_0156	hutG	N-formylglutamate deformylase (EC 3.5.1.68)
Position: -217 Score: 5 Sequence: CAGGTTGTATGGACAAGCTT Position: -115 Score: 5.1 Sequence: AATCCTGTATATACATGTCC Locus tag: Daci_0145 Name: hisX Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein Locus tag: Daci_0146 Name: hisY Funciton: Putative histidine ABC transporter, permease protein Locus tag: Daci_0147 Name: hisZ Funciton: Putative histidine ABC transporter, ATP-binding protein Locus tag: Daci_0148 Name: hutC Funciton: Histidine utilization repressor, GntR family
	Daci_0145	hisX	Putative histidine ABC transporter, periplasmic substrate-binding protein
	Daci_0146	hisY	Putative histidine ABC transporter, permease protein
	Daci_0147	hisZ	Putative histidine ABC transporter, ATP-binding protein
	Daci_0148	hutC	Histidine utilization repressor, GntR family
Position: -449 Score: 5.2 Sequence: CATATTGTATATACAGGCTT Locus tag: Daci_0094 Name: hisT Funciton: Histidine transport protein (permease)
	Daci_0094	hisT	Histidine transport protein (permease)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD