Regulon of HutC in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_0157
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Comamonadaceae
Statistics of regulated genes:
- Genes	13
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -176 Score: 5.1 Sequence: CTTCCTGTATAGACAGCAAT Position: -110 Score: 5.7 Sequence: TATCCTGTATATACAAGTTG Locus tag: Vapar_0154 Name: hisX Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein Locus tag: Vapar_0155 Name: hisY Funciton: Putative histidine ABC transporter, permease protein Locus tag: Vapar_0156 Name: hisZ Funciton: Putative histidine ABC transporter, ATP-binding protein Locus tag: Vapar_0157 Name: hutC Funciton: Histidine utilization repressor, GntR family
	Vapar_0154	hisX	Putative histidine ABC transporter, periplasmic substrate-binding protein
	Vapar_0155	hisY	Putative histidine ABC transporter, permease protein
	Vapar_0156	hisZ	Putative histidine ABC transporter, ATP-binding protein
	Vapar_0157	hutC	Histidine utilization repressor, GntR family
Position: -22 Score: 5.6 Sequence: CTACTTGTATAGACAGGTTC Locus tag: Vapar_0158 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Vapar_0159 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: Vapar_0160 Name: COG1414 Funciton: Transcriptional regulator, IclR family Locus tag: Vapar_0161 Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein Locus tag: Vapar_0162 Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component Locus tag: Vapar_0163 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: Vapar_0164 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: Vapar_0165 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) Locus tag: Vapar_0166 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	Vapar_0158	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	Vapar_0159	hutU	Urocanate hydratase (EC 4.2.1.49)
	Vapar_0160	COG1414	Transcriptional regulator, IclR family
	Vapar_0161	COG834 (HisJ)	ABC amino acid transporter, periplasmic binding protein
	Vapar_0162	COG765 (HisM)	ABC amino acid transporter, permease component
	Vapar_0163	hutD	Conserved hypothetical protein related to histidine degradation
	Vapar_0164	hutI	Imidazolonepropionase (EC 3.5.2.7)
	Vapar_0165	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	Vapar_0166	hutG	N-formylglutamate deformylase (EC 3.5.1.68)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD