Regulon of HutC in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type:	Transcription factor
TF locus tag:	Rfer_4157
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Comamonadaceae
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -221 Score: 5.8 Sequence: AAAGTTGTCTATACAACTTA Locus tag: Rfer_4161 Name: COG1414 Funciton: Transcriptional regulator, IclR family Locus tag: Rfer_4160 Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein Locus tag: Rfer_4159 Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component Locus tag: Rfer_4158 Name: COG1126 (GlnQ) Funciton: ABC amino acid transporter, ATPase component Locus tag: Rfer_4157 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: Rfer_4156 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: Rfer_4155 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68) Locus tag: Rfer_4154 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	Rfer_4161	COG1414	Transcriptional regulator, IclR family
	Rfer_4160	COG834 (HisJ)	ABC amino acid transporter, periplasmic binding protein
	Rfer_4159	COG765 (HisM)	ABC amino acid transporter, permease component
	Rfer_4158	COG1126 (GlnQ)	ABC amino acid transporter, ATPase component
	Rfer_4157	hutC	Histidine utilization repressor, GntR family
	Rfer_4156	hutD	Conserved hypothetical protein related to histidine degradation
	Rfer_4155	hutG	N-formylglutamate deformylase (EC 3.5.1.68)
	Rfer_4154	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD