Regulog HutC - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - HutC
- By TF family - GntR/Others
- By effector - cis-Urocanic acid
- By pathway - Histidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||
| Salmonella typhimurium LT2 | 3 | 1 |
| Citrobacter koseri ATCC BAA-895 | 12 | 3 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 8 | 4 |
| Enterobacter sp. 638 | 5 | 2 |
| Erwinia amylovora ATCC 49946 | 7 | 4 |
| Yersinia pestis KIM | 7 | 4 |
| Serratia proteamaculans 568 | 12 | 4 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | 6 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| COG1457 (CodB) |
|
|
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -111 score = 5.87176 sequence = ATGCTTGTATATACAAGAAC Gene: KPN_01286: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
|
Gene: EAM_2047: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
|
|
|
|
|
|
Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
| CRON 2. | |||||||||||||
| hutU |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -61 score = 5.33952 sequence = CAAGTTGTATAGACAAGTAT Gene: CKO_02357: Urocanate hydratase (EC 4.2.1.49) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -62 score = 6.11964 sequence = ATGCTTGTATAGACAAGTAT Gene: KPN_00795: Urocanate hydratase (EC 4.2.1.49) |
*
Enterobacter sp. 638 Site: position = -58 score = 4.93645 sequence = GGGGTTGTCTATACAAGTAT Gene: Ent638_1263: Urocanate hydratase (EC 4.2.1.49) |
Gene: EAM_1253: Urocanate hydratase (EC 4.2.1.49) |
*
Yersinia pestis KIM Site: position = -72 score = 5.86861 sequence = GTACTTGTCTATACAAGTAT Gene: y4038: Urocanate hydratase (EC 4.2.1.49) |
*
Serratia proteamaculans 568 Site: position = -20 score = 6.28949 sequence = ATGCTTGTACATACAAGTAT Gene: Spro_0805: Urocanate hydratase (EC 4.2.1.49) |
|
|
|
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -69 score = 4.58751 sequence = TCTATTGAATATACATGTAT Site: position = -59 score = 5.98791 sequence = ATACATGTATATACAACTAT Gene: plu3193: Urocanate hydratase (EC 4.2.1.49) |
Urocanate hydratase (EC 4.2.1.49) |
| hutH |
|
Gene: STM0791: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: CKO_02356: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: KPN_00796: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Ent638_1264: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Erwinia amylovora ATCC 49946 Site: position = -83 score = 4.18381 sequence = AGACAAGAATATACAAATGT Site: position = -93 score = 5.04691 sequence = GTAGTTGTATAGACAAGAAT Gene: EAM_1254: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: y4037: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Spro_0804: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
Gene: plu3192: Histidine ammonia-lyase (EC 4.3.1.3) |
Histidine ammonia-lyase (EC 4.3.1.3) |
| hisT |
|
|
|
Gene: KPN_00797: Histidine transport protein (permease) |
|
|
Gene: y4036: Histidine transport protein (permease) |
Gene: Spro_0803: Histidine transport protein (permease) |
|
|
|
Gene: plu3191: Histidine transport protein (permease) |
Histidine transport protein (permease) |
| hutX |
|
|
|
|
|
|
|
Gene: Spro_0802: Histidine ABC transporter, histidine-binding protein (TC 3.A.1) |
|
|
|
|
Histidine ABC transporter, histidine-binding protein (TC 3.A.1) |
| hutW |
|
|
|
|
|
|
|
Gene: Spro_0801: Histidine ABC transporter, permease protein (TC 3.A.1) |
|
|
|
|
Histidine ABC transporter, permease protein (TC 3.A.1) |
| hutV |
|
|
|
|
|
|
|
Gene: Spro_0800: Histidine ABC transporter, ATP-binding protein (TC 3.A.1) |
|
|
|
|
Histidine ABC transporter, ATP-binding protein (TC 3.A.1) |
| hutH2 |
|
|
|
|
|
|
|
Gene: Spro_0799: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
|
Histidine ammonia-lyase (EC 4.3.1.3) |
| CRON 3. | |||||||||||||
| hutI |
|
*
Salmonella typhimurium LT2 Site: position = -43 score = 4.73636 sequence = ATAAATGTCTATACAACCCA Gene: STM0787: Imidazolonepropionase (EC 3.5.2.7) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -29 score = 4.73636 sequence = ATAAATGTATAGACAACCCA Gene: CKO_02360: Imidazolonepropionase (EC 3.5.2.7) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -36 score = 4.73636 sequence = ATAAATGTCTATACAACCCA Gene: KPN_00792: Imidazolonepropionase (EC 3.5.2.7) |
*
Enterobacter sp. 638 Site: position = -4 score = 4.86622 sequence = ATAAATGTCTATACAACTCA Gene: Ent638_1260: Imidazolonepropionase (EC 3.5.2.7) |
*
Erwinia amylovora ATCC 49946 Site: position = -63 score = 4.59801 sequence = GAGGTTGTATATACATATAC Gene: EAM_1258: Imidazolonepropionase (EC 3.5.2.7) |
*
Yersinia pestis KIM Site: position = -113 score = 5.89372 sequence = ATGATTGTATATACAAGTTG Gene: y2340: Imidazolonepropionase (EC 3.5.2.7) |
*
Serratia proteamaculans 568 Site: position = -51 score = 5.87955 sequence = TTAATTGTATATACAACCAT Gene: Spro_2077: Imidazolonepropionase (EC 3.5.2.7) |
Gene: ECA1022: Imidazolonepropionase (EC 3.5.2.7) |
|
|
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -104 score = 5.89505 sequence = ATAAATGTATATACAATTAA Gene: plu3197: Imidazolonepropionase (EC 3.5.2.7) |
Imidazolonepropionase (EC 3.5.2.7) |
| hutG2 |
|
Gene: STM0788: Formiminoglutamase (EC 3.5.3.8) |
Gene: CKO_02359: Formiminoglutamase (EC 3.5.3.8) |
Gene: KPN_00793: Formiminoglutamase (EC 3.5.3.8) |
Gene: Ent638_1261: Formiminoglutamase (EC 3.5.3.8) |
|
|
|
|
|
|
Gene: plu3196: Formiminoglutamase (EC 3.5.3.8) |
Formiminoglutamase (EC 3.5.3.8) |
| hutC |
|
Gene: STM0789: Histidine utilization repressor, GntR family |
Gene: CKO_02358: Histidine utilization repressor, GntR family |
Gene: KPN_00794: Histidine utilization repressor, GntR family |
Gene: Ent638_1262: Histidine utilization repressor, GntR family |
*
Erwinia amylovora ATCC 49946 Site: position = -202 score = 5.04691 sequence = ATTCTTGTCTATACAACTAC Site: position = -212 score = 4.18381 sequence = ACATTTGTATATTCTTGTCT Gene: EAM_1255: Histidine utilization repressor, GntR family |
*
Yersinia pestis KIM Site: position = -80 score = 5.78482 sequence = TTACTTGTATATACATATAC Gene: y2339: Histidine utilization repressor, GntR family |
*
Serratia proteamaculans 568 Site: position = -80 score = 5.32729 sequence = TTAGTTGTATATACATATAC Gene: Spro_2078: Histidine utilization repressor, GntR family |
|
|
|
Gene: plu3195: Histidine utilization repressor, GntR family |
Histidine utilization repressor, GntR family |
| hutG |
|
|
|
|
|
Gene: EAM_1259: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: y2341: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Spro_2076: N-formylglutamate deformylase (EC 3.5.1.68) |
|
|
|
|
N-formylglutamate deformylase (EC 3.5.1.68) |
| CRON 4. | |||||||||||||
| COG1732 (OpuBC) |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -50 score = 5.98323 sequence = TGGTTTGTATATACAAGTAA Gene: CKO_02925: ABC proline/glycine/betaine transporter, periplasmic binding domain |
|
|
|
|
|
|
|
|
|
ABC proline/glycine/betaine transporter, periplasmic binding domain |
| hutH2 |
|
|
Gene: CKO_02926: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
|
|
|
|
|
|
Histidine ammonia-lyase (EC 4.3.1.3) |
| COG1174 (OpuBB) |
|
|
2
Citrobacter koseri ATCC BAA-895 Gene: CKO_02927: ABC proline/glycine/betaine transporter, permease component Gene: CKO_02928: ABC proline/glycine/betaine transporter, permease component |
|
|
|
|
|
|
|
|
|
ABC proline/glycine/betaine transporter, permease component |
| COG1125 (OpuBA) |
|
|
Gene: CKO_02929: ABC proline/glycine/betaine transporter, ATPase component |
|
|
|
|
|
|
|
|
|
ABC proline/glycine/betaine transporter, ATPase component |
| COG2423 |
|
|
Gene: CKO_02930: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12) |
|
|
|
|
|
|
|
|
|
Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12) |
| COG3221 (PhnD) |
|
|
Gene: CKO_02931: ABC phosphate/phosphonate transporter, periplasmic binding component |
|
Gene: Ent638_2351: ABC phosphate/phosphonate transporter, periplasmic binding component |
|
|
Gene: Spro_1449: ABC phosphate/phosphonate transporter, periplasmic binding component |
|
|
|
|
ABC phosphate/phosphonate transporter, periplasmic binding component |
| CRON 5. | |||||||||||||
| hutF |
|
|
|
|
|
*
Erwinia amylovora ATCC 49946 Site: position = -38 score = 4.59801 sequence = GTATATGTATATACAACCTC Gene: EAM_1257: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
*
Yersinia pestis KIM Site: position = -33 score = 5.78482 sequence = GTATATGTATATACAAGTAA Gene: y2338: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
*
Serratia proteamaculans 568 Site: position = -117 score = 5.32729 sequence = GTATATGTATATACAACTAA Gene: Spro_2079: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
|
|
|
|
Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
| hutD |
Gene: b1742: Conserved hypothetical protein related to histidine degradation |
|
Gene: CKO_01767: Conserved hypothetical protein related to histidine degradation |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -147 score = 5.87176 sequence = GTTCTTGTATATACAAGCAT Gene: KPN_01285: Conserved hypothetical protein related to histidine degradation |
Gene: Ent638_1702: Conserved hypothetical protein related to histidine degradation |
Gene: EAM_1256: Conserved hypothetical protein related to histidine degradation |
Gene: y2337: Conserved hypothetical protein related to histidine degradation |
Gene: Spro_2080: Conserved hypothetical protein related to histidine degradation |
|
|
|
|
Conserved hypothetical protein related to histidine degradation |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |