Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hutH2 gene

Properties
Regulog: HutC - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Built upon 27 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -50
Score: 5.98323
Sequence: TGGTTTGTATATACAAGTAA
Locus tag: CKO_02925
Name: COG1732 (OpuBC)
Funciton: ABC proline/glycine/betaine transporter, periplasmic binding domain
Locus tag: CKO_02926
Name: hutH2
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: CKO_02927
Name: COG1174 (OpuBB)
Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: CKO_02928
Name: COG1174 (OpuBB)
Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: CKO_02929
Name: COG1125 (OpuBA)
Funciton: ABC proline/glycine/betaine transporter, ATPase component
Locus tag: CKO_02930
Name: COG2423
Funciton: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
Locus tag: CKO_02931
Name: COG3221 (PhnD)
Funciton: ABC phosphate/phosphonate transporter, periplasmic binding component
COG1732 (OpuBC)-hutH2-COG1174 (OpuBB)-COG1174 (OpuBB)-COG1125 (OpuBA)-COG2423-COG3221 (PhnD) -50 6 TGGTTTGTATATACAAGTAA CKO_02925