Regulon of HutC in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_02358
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Enterobacteriales
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.3 Sequence: CAAGTTGTATAGACAAGTAT Locus tag: CKO_02357 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: CKO_02356 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
	CKO_02357	hutU	Urocanate hydratase (EC 4.2.1.49)
	CKO_02356	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
Position: -29 Score: 4.7 Sequence: ATAAATGTATAGACAACCCA Locus tag: CKO_02360 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: CKO_02359 Name: hutG2 Funciton: Formiminoglutamase (EC 3.5.3.8) Locus tag: CKO_02358 Name: hutC Funciton: Histidine utilization repressor, GntR family
	CKO_02360	hutI	Imidazolonepropionase (EC 3.5.2.7)
	CKO_02359	hutG2	Formiminoglutamase (EC 3.5.3.8)
	CKO_02358	hutC	Histidine utilization repressor, GntR family
Position: -50 Score: 6 Sequence: TGGTTTGTATATACAAGTAA Locus tag: CKO_02925 Name: COG1732 (OpuBC) Funciton: ABC proline/glycine/betaine transporter, periplasmic binding domain Locus tag: CKO_02926 Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: CKO_02927 Name: COG1174 (OpuBB) Funciton: ABC proline/glycine/betaine transporter, permease component Locus tag: CKO_02928 Name: COG1174 (OpuBB) Funciton: ABC proline/glycine/betaine transporter, permease component Locus tag: CKO_02929 Name: COG1125 (OpuBA) Funciton: ABC proline/glycine/betaine transporter, ATPase component Locus tag: CKO_02930 Name: COG2423 Funciton: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12) Locus tag: CKO_02931 Name: COG3221 (PhnD) Funciton: ABC phosphate/phosphonate transporter, periplasmic binding component
	CKO_02925	COG1732 (OpuBC)	ABC proline/glycine/betaine transporter, periplasmic binding domain
	CKO_02926	hutH2	Histidine ammonia-lyase (EC 4.3.1.3)
	CKO_02927	COG1174 (OpuBB)	ABC proline/glycine/betaine transporter, permease component
	CKO_02928	COG1174 (OpuBB)	ABC proline/glycine/betaine transporter, permease component
	CKO_02929	COG1125 (OpuBA)	ABC proline/glycine/betaine transporter, ATPase component
	CKO_02930	COG2423	Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
	CKO_02931	COG3221 (PhnD)	ABC phosphate/phosphonate transporter, periplasmic binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD