Regulon of HutC in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_00794
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 5.9 Sequence: ATGCTTGTATATACAAGAAC Locus tag: KPN_01286 Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
	KPN_01286	COG1457 (CodB)	Permease, cytosine/purines, uracil, thiamine, allantoin family protein
Position: -147 Score: 5.9 Sequence: GTTCTTGTATATACAAGCAT Locus tag: KPN_01285 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
	KPN_01285	hutD	Conserved hypothetical protein related to histidine degradation
Position: -36 Score: 4.7 Sequence: ATAAATGTCTATACAACCCA Locus tag: KPN_00792 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: KPN_00793 Name: hutG2 Funciton: Formiminoglutamase (EC 3.5.3.8) Locus tag: KPN_00794 Name: hutC Funciton: Histidine utilization repressor, GntR family
	KPN_00792	hutI	Imidazolonepropionase (EC 3.5.2.7)
	KPN_00793	hutG2	Formiminoglutamase (EC 3.5.3.8)
	KPN_00794	hutC	Histidine utilization repressor, GntR family
Position: -62 Score: 6.1 Sequence: ATGCTTGTATAGACAAGTAT Locus tag: KPN_00795 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: KPN_00796 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: KPN_00797 Name: hisT Funciton: Histidine transport protein (permease)
	KPN_00795	hutU	Urocanate hydratase (EC 4.2.1.49)
	KPN_00796	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	KPN_00797	hisT	Histidine transport protein (permease)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD