Regulog Zur - Desulfuromonadales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfuromonadales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Geobacter metallireducens GS-15 | ||
| Geobacter sulfurreducens PCA | 4 | 1 |
| Geobacter uraniumreducens Rf4 | 4 | 1 |
| Geobacter sp. FRC-32 | 4 | 1 |
| Geobacter sp. M21 | 4 | 1 |
| Geobacter lovleyi SZ | ||
| Pelobacter propionicus DSM 2379 | ||
| Pelobacter carbinolicus str. DSM 2380 | ||
| Desulfuromonas acetoxidans DSM 684 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| zur |
|
*
Geobacter sulfurreducens PCA Site: position = -41 score = 7.47762 sequence = TAAATGGAAATGATTTCTGTTTA Gene: GSU2987: Zinc uptake regulation protein Zur |
*
Geobacter uraniumreducens Rf4 Site: position = -217 score = 7.93219 sequence = TAAAAAGAAATGATTTCTATTTA Gene: Gura_0045: Zinc uptake regulation protein Zur |
*
Geobacter sp. FRC-32 Site: position = -51 score = 7.93219 sequence = TAAAAAGAAATGATTTCTATTTA Gene: Geob_0042: Zinc uptake regulation protein Zur |
*
Geobacter sp. M21 Site: position = -32 score = 7.47762 sequence = TAAAACGAAATCATTTCCATTTA Gene: GM21_3601: Zinc uptake regulation protein Zur |
|
|
|
|
Zinc uptake regulation protein Zur |
| znuA |
Gene: Gmet_0491: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: GSU2986: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Gura_0046: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Geob_0043: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: GM21_3600: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Glov_1833: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Ppro_2139: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuC |
Gene: Gmet_0492: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: GSU2985: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Gura_0047: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Geob_0044: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: GM21_3599: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Glov_1834: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Ppro_2138: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: Gmet_0493: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: GSU2984: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Gura_0048: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Geob_0045: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: GM21_3598: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Glov_1835: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Ppro_2137: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |