Regulon of Zur in Geobacter uraniumreducens Rf4

Properties
Regulator type:	Transcription factor
TF locus tag:	Gura_0045
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Desulfuromonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -217 Score: 7.9 Sequence: TAAAAAGAAATGATTTCTATTTA Locus tag: Gura_0045 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Gura_0046 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Gura_0047 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Gura_0048 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Gura_0045	zur	Zinc uptake regulation protein Zur
	Gura_0046	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Gura_0047	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Gura_0048	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD