Regulon of Zur in Geobacter sulfurreducens PCA

Properties
Regulator type:	Transcription factor
TF locus tag:	GSU2987
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Desulfuromonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 7.5 Sequence: TAAATGGAAATGATTTCTGTTTA Locus tag: GSU2987 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: GSU2986 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: GSU2985 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: GSU2984 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	GSU2987	zur	Zinc uptake regulation protein Zur
	GSU2986	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	GSU2985	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	GSU2984	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD