Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing zur gene

Properties
Regulog: Zur - Desulfuromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/delta
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Geobacter sp. FRC-32
Position: -51
Score: 7.93219
Sequence: TAAAAAGAAATGATTTCTATTTA
Locus tag: Geob_0042
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Geob_0043
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Geob_0044
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Geob_0045
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB -51 7.9 TAAAAAGAAATGATTTCTATTTA Geob_0042
Geobacter sp. M21
Position: -32
Score: 7.47762
Sequence: TAAAACGAAATCATTTCCATTTA
Locus tag: GM21_3601
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: GM21_3600
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: GM21_3599
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: GM21_3598
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB -32 7.5 TAAAACGAAATCATTTCCATTTA GM21_3601
Geobacter sulfurreducens PCA
Position: -41
Score: 7.47762
Sequence: TAAATGGAAATGATTTCTGTTTA
Locus tag: GSU2987
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: GSU2986
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: GSU2985
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: GSU2984
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB -41 7.5 TAAATGGAAATGATTTCTGTTTA GSU2987
Geobacter uraniumreducens Rf4
Position: -217
Score: 7.93219
Sequence: TAAAAAGAAATGATTTCTATTTA
Locus tag: Gura_0045
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Gura_0046
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Gura_0047
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Gura_0048
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB -217 7.9 TAAAAAGAAATGATTTCTATTTA Gura_0045