Regulog Zur - Moraxellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Acinetobacter sp. ADP1	17	11
Acinetobacter baumannii AB0057	9	7
Psychrobacter arcticum 273-4	5	3
Psychrobacter sp. PRwf-1	9	7

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
znuA2	Acinetobacter sp. ADP1	Acinetobacter baumannii AB0057	Psychrobacter arcticum 273-4	* Psychrobacter sp. PRwf-1 Site: position = -100 score = 6.37037 sequence = TTATTGTTATAATATAACATACT Gene: PsycPRwf_1910: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

CRON 2.
yciC	* Acinetobacter sp. ADP1 Site: position = -128 score = 6.44328 sequence = TATATGTTACATTATAACATAAC Gene: ACIAD1741: Putative metal chaperone, GTPase of COG0523 family	* Acinetobacter baumannii AB0057 Site: position = -77 score = 6.39958 sequence = GTTATGTTATAACATAACATTAT Gene: AB57_3864: Putative metal chaperone, GTPase of COG0523 family	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Putative metal chaperone, GTPase of COG0523 family
folE2	Acinetobacter sp. ADP1 Gene: ACIAD1740: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Acinetobacter baumannii AB0057	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	GTP cyclohydrolase I (EC 3.5.4.16) type 2

CRON 3.
znuA	* Acinetobacter sp. ADP1 Site: position = -36 score = 5.65671 sequence = AATTTGTTATAATATAACACAAG Gene: ACIAD0177: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Acinetobacter baumannii AB0057 Site: position = -51 score = 5.81642 sequence = ACTTTGTTATATTATAACATGCT Gene: AB57_0185: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Psychrobacter arcticum 273-4 Site: position = -83 score = 6.80324 sequence = ATTATGTTATAGTATAACATAAT Gene: Psyc_2032: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Psychrobacter sp. PRwf-1 Site: position = -142 score = 6.09874 sequence = TATTAGTTATAGTATAACATATC Gene: PsycPRwf_0185: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

CRON 4.
zur	* Acinetobacter sp. ADP1 Site: position = -97 score = 6.10945 sequence = CTTGTGTTATATTATAACAAATT Gene: ACIAD0176: Zinc uptake regulation protein ZUR	* Acinetobacter baumannii AB0057 Site: position = -111 score = 5.93125 sequence = AGCATGTTATAATATAACAAAGT Gene: AB57_0184: Zinc uptake regulation protein ZUR	* Psychrobacter arcticum 273-4 Site: position = -187 score = 6.76161 sequence = ATTATGTTATACTATAACATAAT Gene: Psyc_2033: Zinc uptake regulation protein ZUR	* Psychrobacter sp. PRwf-1 Site: position = -408 score = 5.80252 sequence = GATATGTTATACTATAACTAATA Gene: PsycPRwf_0184: Zinc uptake regulation protein ZUR	Zinc uptake regulation protein ZUR
znuC	Acinetobacter sp. ADP1 Gene: ACIAD0175: Zinc ABC transporter, ATP-binding protein ZnuC	Acinetobacter baumannii AB0057 Gene: AB57_0183: Zinc ABC transporter, ATP-binding protein ZnuC	Psychrobacter arcticum 273-4 Gene: Psyc_2034: Zinc ABC transporter, ATP-binding protein ZnuC	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_0183: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	Acinetobacter sp. ADP1 Gene: ACIAD0174: Zinc ABC transporter, inner membrane permease protein ZnuB	Acinetobacter baumannii AB0057 Gene: AB57_0182: Zinc ABC transporter, inner membrane permease protein ZnuB	Psychrobacter arcticum 273-4 Gene: Psyc_2035: Zinc ABC transporter, inner membrane permease protein ZnuB	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_0182: Zinc ABC transporter, inner membrane permease protein ZnuB	Zinc ABC transporter, inner membrane permease protein ZnuB

CRON 5.
omr3	* Acinetobacter sp. ADP1 Site: position = -54 score = 6.1914 sequence = GTAATGTTATAGTATTACAATTA Gene: ACIAD1003: Ferrichrome-iron receptor	* Acinetobacter baumannii AB0057 Site: position = -54 score = 5.90106 sequence = GTAACGTTATACTATTACATTTA Gene: AB57_0135: Ferrichrome-iron receptor	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Ferrichrome-iron receptor

CRON 6.
rpmE2	* Acinetobacter sp. ADP1 Site: position = -54 score = 6.17714 sequence = AAAATGAAATAATATAACATTAC Gene: ACIAD0425: LSU ribosomal protein L31p	* Acinetobacter baumannii AB0057 Site: position = -54 score = 6.00088 sequence = TGAGTGTTATGTTATAACATTTC Gene: AB57_0468: LSU ribosomal protein L31p	Psychrobacter arcticum 273-4 Gene: Psyc_1916: LSU ribosomal protein L31p	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_0507: LSU ribosomal protein L31p	LSU ribosomal protein L31p

CRON 7.
rpmJ	Acinetobacter sp. ADP1	Acinetobacter baumannii AB0057	Psychrobacter arcticum 273-4	* Psychrobacter sp. PRwf-1 Site: position = -121 score = 6.59972 sequence = TTAATGTTATGTTATAACATAAT Gene: PsycPRwf_1926: LSU ribosomal protein L36p	LSU ribosomal protein L36p

CRON 8.
omr1	2 Acinetobacter sp. ADP1* Site: position = -25 score = 5.45793 sequence = AAATAGATATATTATAACGTAAC Gene: ACIAD0612: Zinc-regulated outer membrane receptor Site: position = -64 score = 6.191 sequence = GCAATGTTATAATATTACAAAAA Gene: ACIAD0611: Zinc-regulated outer membrane receptor	2 Acinetobacter baumannii AB0057* Site: position = -41 score = 6.04069 sequence = TAAGTGTTATATTATAATATAAC Gene: AB57_3926: Zinc-regulated outer membrane receptor Site: position = -51 score = 6.71441 sequence = GAAATGTTATAATATAACAAAAC Gene: AB57_3396: Zinc-regulated outer membrane receptor	Psychrobacter arcticum 273-4	2 Psychrobacter sp. PRwf-1* Site: position = -92 score = 6.76161 sequence = GTTATGTTATACTATAACATAAC Gene: PsycPRwf_2339: Zinc-regulated outer membrane receptor Site: position = -86 score = 6.80324 sequence = GTTATGTTATAGTATAACATAAC Gene: PsycPRwf_2340: Zinc-regulated outer membrane receptor	Zinc-regulated outer membrane receptor

CRON 9.
Psyc_1790	Acinetobacter sp. ADP1	Acinetobacter baumannii AB0057	* Psychrobacter arcticum 273-4 Site: position = -165 score = 5.67059 sequence = AAATTGATATATTATAAAATAAT Gene: Psyc_1790: Zn-dependent hydrolases, including glyoxylases	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_0570: Zn-dependent hydrolases, including glyoxylases	Zn-dependent hydrolases, including glyoxylases

CRON 10.
ACIAD1328	* Acinetobacter sp. ADP1 Site: position = -43 score = 5.03315 sequence = GGAATGTTATAGTATTTGAAATT Gene: ACIAD1328: Zinc metalloprotease (EC 3.4.24.-)	Acinetobacter baumannii AB0057 Gene: AB57_2603: Zinc metalloprotease (EC 3.4.24.-)	Psychrobacter arcticum 273-4 Gene: Psyc_0209: Zinc metalloprotease (EC 3.4.24.-)	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_0358: Zinc metalloprotease (EC 3.4.24.-)	Zinc metalloprotease (EC 3.4.24.-)

CRON 11.
tonB	* Acinetobacter sp. ADP1 Site: position = -253 score = 5.70807 sequence = AAAGTATTATGTTATAACATAAT Gene: ACIAD0507: Ferric siderophore transport system, periplasmic binding protein TonB	Acinetobacter baumannii AB0057 Gene: AB57_0535: Ferric siderophore transport system, periplasmic binding protein TonB	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Ferric siderophore transport system, periplasmic binding protein TonB
exbB	Acinetobacter sp. ADP1 Gene: ACIAD0508: MotA/TolQ/ExbB proton channel family protein	Acinetobacter baumannii AB0057 Gene: AB57_0536: MotA/TolQ/ExbB proton channel family protein	Psychrobacter arcticum 273-4 Gene: Psyc_1663: MotA/TolQ/ExbB proton channel family protein	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_1513: MotA/TolQ/ExbB proton channel family protein	MotA/TolQ/ExbB proton channel family protein
exbD	Acinetobacter sp. ADP1 Gene: ACIAD0509: Biopolymer transport protein ExbD/TolR	Acinetobacter baumannii AB0057 Gene: AB57_0537: Biopolymer transport protein ExbD/TolR	Psychrobacter arcticum 273-4 Gene: Psyc_1662: Biopolymer transport protein ExbD/TolR	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_1512: Biopolymer transport protein ExbD/TolR	Biopolymer transport protein ExbD/TolR

CRON 12.
can	* Acinetobacter sp. ADP1 Site: position = -101 score = 6.32285 sequence = TATTTGTTATGTTATAACATAAC Gene: ACIAD1420: Carbonic anhydrase, gamma class (EC 4.2.1.1)	Acinetobacter baumannii AB0057	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Carbonic anhydrase, gamma class (EC 4.2.1.1)
pyrC2	Acinetobacter sp. ADP1 Gene: ACIAD1419: Dihydroorotase (EC 3.5.2.3)	Acinetobacter baumannii AB0057 Gene: AB57_1001: Dihydroorotase (EC 3.5.2.3)	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Dihydroorotase (EC 3.5.2.3)

CRON 13.
omr2	Acinetobacter sp. ADP1	Acinetobacter baumannii AB0057	Psychrobacter arcticum 273-4	* Psychrobacter sp. PRwf-1 Site: position = -97 score = 5.01819 sequence = AAAACGTTATGTTATACTATAAC Gene: PsycPRwf_2339: Zinc-regulated outer membrane receptor	Zinc-regulated outer membrane receptor

CRON 14.
ACIAD1742	* Acinetobacter sp. ADP1 Site: position = -44 score = 5.12065 sequence = CCAATGTTATAATGTAACAGTTA Gene: ACIAD1742: hypothetical protein; putative signal peptide	Acinetobacter baumannii AB0057	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	hypothetical protein; putative signal peptide

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Moraxellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --