Regulon of Zur in Psychrobacter sp. PRwf-1

Properties
Regulator type:	Transcription factor
TF locus tag:	PsycPRwf_0184
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Moraxellaceae
Statistics of regulated genes:
- Genes	9
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -142 Score: 6.1 Sequence: TATTAGTTATAGTATAACATATC Locus tag: PsycPRwf_0185 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PsycPRwf_0185	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -92 Score: 6.8 Sequence: GTTATGTTATACTATAACATAAC Locus tag: PsycPRwf_2339 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	PsycPRwf_2339	omr1	Zinc-regulated outer membrane receptor
Position: -86 Score: 6.8 Sequence: GTTATGTTATAGTATAACATAAC Locus tag: PsycPRwf_2340 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	PsycPRwf_2340	omr1	Zinc-regulated outer membrane receptor
Position: -408 Score: 5.8 Sequence: GATATGTTATACTATAACTAATA Locus tag: PsycPRwf_0184 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PsycPRwf_0183 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PsycPRwf_0182 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PsycPRwf_0184	zur	Zinc uptake regulation protein ZUR
	PsycPRwf_0183	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PsycPRwf_0182	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -100 Score: 6.4 Sequence: TTATTGTTATAATATAACATACT Locus tag: PsycPRwf_1910 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PsycPRwf_1910	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -97 Score: 5 Sequence: AAAACGTTATGTTATACTATAAC Locus tag: PsycPRwf_2339 Name: omr2 Funciton: Zinc-regulated outer membrane receptor
	PsycPRwf_2339	omr2	Zinc-regulated outer membrane receptor
Position: -121 Score: 6.6 Sequence: TTAATGTTATGTTATAACATAAT Locus tag: PsycPRwf_1926 Name: PsycPRwf_1926 Funciton: LSU ribosomal protein L36p
	PsycPRwf_1926	PsycPRwf_1926	LSU ribosomal protein L36p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD