Regulon of Zur in Acinetobacter baumannii AB0057

Properties
Regulator type:	Transcription factor
TF locus tag:	AB57_0184
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Moraxellaceae
Statistics of regulated genes:
- Genes	9
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 6.4 Sequence: GTTATGTTATAACATAACATTAT Locus tag: AB57_3864 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family
	AB57_3864	yciC	Putative metal chaperone, GTPase of COG0523 family
Position: -51 Score: 5.8 Sequence: ACTTTGTTATATTATAACATGCT Locus tag: AB57_0185 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	AB57_0185	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -51 Score: 6.7 Sequence: GAAATGTTATAATATAACAAAAC Locus tag: AB57_3396 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	AB57_3396	omr1	Zinc-regulated outer membrane receptor
Position: -111 Score: 5.9 Sequence: AGCATGTTATAATATAACAAAGT Locus tag: AB57_0184 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: AB57_0183 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: AB57_0182 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	AB57_0184	zur	Zinc uptake regulation protein ZUR
	AB57_0183	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	AB57_0182	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -41 Score: 6 Sequence: TAAGTGTTATATTATAATATAAC Locus tag: AB57_3926 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	AB57_3926	omr1	Zinc-regulated outer membrane receptor
Position: -54 Score: 5.9 Sequence: GTAACGTTATACTATTACATTTA Locus tag: AB57_0135 Name: omr3 Funciton: Ferrichrome-iron receptor
	AB57_0135	omr3	Ferrichrome-iron receptor
Position: -54 Score: 6 Sequence: TGAGTGTTATGTTATAACATTTC Locus tag: AB57_0468 Name: rpmE2 Funciton: LSU ribosomal protein L31p
	AB57_0468	rpmE2	LSU ribosomal protein L31p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD