Regulon of Zur in Psychrobacter arcticum 273-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Psyc_2033
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Moraxellaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -165 Score: 5.7 Sequence: AAATTGATATATTATAAAATAAT Locus tag: Psyc_1790 Name: Psyc_1790 Funciton: Zn-dependent hydrolases, including glyoxylases
	Psyc_1790	Psyc_1790	Zn-dependent hydrolases, including glyoxylases
Position: -187 Score: 6.8 Sequence: ATTATGTTATACTATAACATAAT Locus tag: Psyc_2033 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Psyc_2034 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Psyc_2035 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Psyc_2033	zur	Zinc uptake regulation protein ZUR
	Psyc_2034	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Psyc_2035	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -83 Score: 6.8 Sequence: ATTATGTTATAGTATAACATAAT Locus tag: Psyc_2032 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Psyc_2032	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD