Regulog NsrR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40	2	1
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107	4	2
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297	3	2
Alcanivorax borkumensis SK2	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
DUF454	Hahella chejuensis KCTC 2396	Marinobacter aqueolei Gene: Maqu_3072: Hypothetical protein DUF454	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	* Cellvibrio japonicus Ueda107 Site: position = -50 score = 5.4342 sequence = AGATGCAAAATAAATGAATCT Gene: CJA_1547: Hypothetical protein DUF454	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Hypothetical protein DUF454
nnrS	Hahella chejuensis KCTC 2396 Gene: HCH_01371: NnrS protein involved in response to NO	Marinobacter aqueolei Gene: Maqu_3145: NnrS protein involved in response to NO	Marinobacter sp. ELB17 Gene: MELB17_04242: NnrS protein involved in response to NO	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	* Saccharophagus degradans 2-40 Site: position = -82 score = 4.90917 sequence = AGATGTAATATACATGCATCT Site: position = -56 score = 5.25764 sequence = AGATGCATAATAAATGTATCT Gene: Sde_0102: NnrS protein involved in response to NO	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_1548: NnrS protein involved in response to NO	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_07536: NnrS protein involved in response to NO	Alcanivorax borkumensis SK2 Gene: ABO_2561: NnrS protein involved in response to NO	NnrS protein involved in response to NO
nsrR	Hahella chejuensis KCTC 2396	Marinobacter aqueolei Gene: Maqu_3071: Nitrite-sensitive transcriptional repressor NsrR	Marinobacter sp. ELB17 Gene: MELB17_04687: Nitrite-sensitive transcriptional repressor NsrR	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_0101: Nitrite-sensitive transcriptional repressor NsrR	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_1549: Nitrite-sensitive transcriptional repressor NsrR	Chromohalobacter salexigens DSM 3043	2 Reinekea sp. MED297* Site: position = -44 score = 5.49759 sequence = AGATGTATATTAAATGCATCT Gene: MED297_07531: Nitrite-sensitive transcriptional repressor NsrR Site: position = -193 score = 4.07904 sequence = AAATGTAATTTAATTACATAA Gene: MED297_17612: Nitrite-sensitive transcriptional repressor NsrR	* Alcanivorax borkumensis SK2 Site: position = -27 score = 4.10211 sequence = AGATACTCATTTTTTGGAGGT Gene: ABO_2120: Nitrite-sensitive transcriptional repressor NsrR	Nitrite-sensitive transcriptional repressor NsrR
hmp	Hahella chejuensis KCTC 2396 Gene: HCH_01369: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_0066: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_0471: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_0452: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Reinekea sp. MED297	* Alcanivorax borkumensis SK2 Site: position = -84 score = 4.10211 sequence = ACCTCCAAAAAATGAGTATCT Gene: ABO_2119: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)

CRON 2.
norB	Hahella chejuensis KCTC 2396 Gene: HCH_00713: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	* Cellvibrio japonicus Ueda107 Site: position = -88 score = 5.4342 sequence = AGATTCATTTATTTTGCATCT Gene: CJA_1546: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NsrR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --