Regulog NsrR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - NsrR
- By TF family - Rrf2
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | ||
| Saccharophagus degradans 2-40 | 2 | 1 |
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | 4 | 2 |
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | 3 | 2 |
| Alcanivorax borkumensis SK2 | 2 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| DUF454 |
|
Gene: Maqu_3072: Hypothetical protein DUF454 |
|
|
|
|
|
|
*
Cellvibrio japonicus Ueda107 Site: position = -50 score = 5.4342 sequence = AGATGCAAAATAAATGAATCT Gene: CJA_1547: Hypothetical protein DUF454 |
|
|
|
Hypothetical protein DUF454 |
| nnrS |
Gene: HCH_01371: NnrS protein involved in response to NO |
Gene: Maqu_3145: NnrS protein involved in response to NO |
Gene: MELB17_04242: NnrS protein involved in response to NO |
|
|
|
*
Saccharophagus degradans 2-40 Site: position = -82 score = 4.90917 sequence = AGATGTAATATACATGCATCT Site: position = -56 score = 5.25764 sequence = AGATGCATAATAAATGTATCT Gene: Sde_0102: NnrS protein involved in response to NO |
|
Gene: CJA_1548: NnrS protein involved in response to NO |
|
Gene: MED297_07536: NnrS protein involved in response to NO |
Gene: ABO_2561: NnrS protein involved in response to NO |
NnrS protein involved in response to NO |
| nsrR |
|
Gene: Maqu_3071: Nitrite-sensitive transcriptional repressor NsrR |
Gene: MELB17_04687: Nitrite-sensitive transcriptional repressor NsrR |
|
|
|
Gene: Sde_0101: Nitrite-sensitive transcriptional repressor NsrR |
|
Gene: CJA_1549: Nitrite-sensitive transcriptional repressor NsrR |
|
*2
Reinekea sp. MED297 Site: position = -44 score = 5.49759 sequence = AGATGTATATTAAATGCATCT Gene: MED297_07531: Nitrite-sensitive transcriptional repressor NsrR Site: position = -193 score = 4.07904 sequence = AAATGTAATTTAATTACATAA Gene: MED297_17612: Nitrite-sensitive transcriptional repressor NsrR |
*
Alcanivorax borkumensis SK2 Site: position = -27 score = 4.10211 sequence = AGATACTCATTTTTTGGAGGT Gene: ABO_2120: Nitrite-sensitive transcriptional repressor NsrR |
Nitrite-sensitive transcriptional repressor NsrR |
| hmp |
Gene: HCH_01369: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
|
|
|
|
Gene: Mmwyl1_0066: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
|
Gene: TERTU_0471: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
|
Gene: Csal_0452: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
|
*
Alcanivorax borkumensis SK2 Site: position = -84 score = 4.10211 sequence = ACCTCCAAAAAATGAGTATCT Gene: ABO_2119: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
| CRON 2. | |||||||||||||
| norB |
Gene: HCH_00713: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
|
|
|
|
|
|
|
*
Cellvibrio japonicus Ueda107 Site: position = -88 score = 5.4342 sequence = AGATTCATTTATTTTGCATCT Gene: CJA_1546: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
|
|
|
Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |