Regulon of NsrR in Cellvibrio japonicus Ueda107

Properties
Regulator type:	Transcription factor
TF locus tag:	CJA_1549
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5.4 Sequence: AGATGCAAAATAAATGAATCT Locus tag: CJA_1547 Name: DUF454 Funciton: Hypothetical protein DUF454 Locus tag: CJA_1548 Name: nnrS Funciton: NnrS protein involved in response to NO Locus tag: CJA_1549 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
	CJA_1547	DUF454	Hypothetical protein DUF454
	CJA_1548	nnrS	NnrS protein involved in response to NO
	CJA_1549	nsrR	Nitrite-sensitive transcriptional repressor NsrR
Position: -88 Score: 5.4 Sequence: AGATTCATTTATTTTGCATCT Locus tag: CJA_1546 Name: norB Funciton: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
	CJA_1546	norB	Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD