Regulon of NsrR in Alcanivorax borkumensis SK2

Properties
Regulator type:	Transcription factor
TF locus tag:	ABO_2120
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 4.1 Sequence: ACCTCCAAAAAATGAGTATCT Locus tag: ABO_2119 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	ABO_2119	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Position: -27 Score: 4.1 Sequence: AGATACTCATTTTTTGGAGGT Locus tag: ABO_2120 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
	ABO_2120	nsrR	Nitrite-sensitive transcriptional repressor NsrR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD