Regulon of NsrR in Reinekea sp. MED297

Properties
Regulator type:	Transcription factor
TF locus tag:	MED297_17612, MED297_07531
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 5.5 Sequence: AGATGTATATTAAATGCATCT Locus tag: MED297_07531 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR Locus tag: MED297_07536 Name: nnrS Funciton: NnrS protein involved in response to NO
	MED297_07531	nsrR	Nitrite-sensitive transcriptional repressor NsrR
	MED297_07536	nnrS	NnrS protein involved in response to NO
Position: -193 Score: 4.1 Sequence: AAATGTAATTTAATTACATAA Locus tag: MED297_17612 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
	MED297_17612	nsrR	Nitrite-sensitive transcriptional repressor NsrR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD