Regulog SmtB - Cyanobacteria

Properties
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Statistics of regulated genes
Genome	Genes	Operons
Cyanothece sp. ATCC 51142
Cyanothece sp. PCC 7425	1	1
Cyanothece sp. PCC 8801	1	1
Gloeobacter violaceus PCC 7421
Microcystis aeruginosa NIES-843	1	1
Nostoc sp. PCC 7120	2	2
Prochlorococcus marinus str. MIT 9313
Synechococcus elongatus PCC 7942	2	2
Synechococcus sp. JA-3-3Ab
Synechococcus sp. PCC 7002	2	2
Synechococcus sp. WH 8102
Synechocystis sp. PCC 6803	2	2
Thermosynechococcus elongatus BP-1	1	1
Trichodesmium erythraeum IMS101

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes															Function

CRON 1.
smtB	Cyanothece sp. ATCC 51142	* Cyanothece sp. PCC 7425 Site: position = -124 score = 7.26883 sequence = AACATCTGAACAACTGTTCATATGTT Gene: Cyan7425_4462: Zinc stress transcriptional regulator, ArsR family	Cyanothece sp. PCC 8801 Gene: PCC8801_0860: Zinc stress transcriptional regulator, ArsR family	Gloeobacter violaceus PCC 7421	* Microcystis aeruginosa NIES-843 Site: position = -269 score = 6.65832 sequence = AATCCATGAACATCTGTTCAGATGTT Gene: MAE_02380: Zinc stress transcriptional regulator, ArsR family	2 Nostoc sp. PCC 7120* Site: position = -85 score = 6.43055 sequence = AACAATTGAACAACTATTCAATTGTA Gene: all7621 (deprecated): Zinc stress transcriptional regulator, ArsR family Gene: alr0831: Zinc stress transcriptional regulator, ArsR family	Prochlorococcus marinus str. MIT 9313	* Synechococcus elongatus PCC 7942 Site: position = -84 score = 7.12847 sequence = AATATCTGAATAACTGTTCATGTGTT Site: position = -52 score = 6.27829 sequence = AACATCTGAATCTTGATTCAGGTATG Gene: Synpcc7942_1291: Zinc stress transcriptional regulator, ArsR family	Synechococcus sp. JA-3-3Ab	* Synechococcus sp. PCC 7002 Site: position = -43 score = 7.20512 sequence = AACACATGAACAATTATTCAGGTATT Site: position = -75 score = 6.17635 sequence = AATAGTTGAACGATTGTTCACATTTT Gene: SYNPCC7002_A2564: Zinc stress transcriptional regulator, ArsR family	Synechococcus sp. WH 8102	* Synechocystis sp. PCC 6803 Site: position = -97 score = 6.52555 sequence = AACACCTGAAGATATGCTCAGATATT Gene: sll0792: Zinc stress transcriptional regulator, ArsR family	Thermosynechococcus elongatus BP-1 Gene: tlr1018: Zinc stress transcriptional regulator, ArsR family	Trichodesmium erythraeum IMS101	Zinc stress transcriptional regulator, ArsR family

CRON 2.
smtA	Cyanothece sp. ATCC 51142 Gene: cce_2496: Metallothionein	Cyanothece sp. PCC 7425	* Cyanothece sp. PCC 8801 Site: position = -71 score = 6.92871 sequence = AATATCTGAATACCTGTTCAGATGTT Gene: PCC8801_0861: Metallothionein	Gloeobacter violaceus PCC 7421 Gene: gsl3430: Metallothionein	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Prochlorococcus marinus str. MIT 9313	* Synechococcus elongatus PCC 7942 Site: position = -74 score = 6.27829 sequence = CATACCTGAATCAAGATTCAGATGTT Site: position = -42 score = 7.12847 sequence = AACACATGAACAGTTATTCAGATATT Gene: Synpcc7942_1290: Metallothionein	Synechococcus sp. JA-3-3Ab	* Synechococcus sp. PCC 7002 Site: position = -85 score = 7.20512 sequence = AATACCTGAATAATTGTTCATGTGTT Site: position = -53 score = 6.17635 sequence = AAAATGTGAACAATCGTTCAACTATT Gene: SYNPCC7002_A2563: Metallothionein	Synechococcus sp. WH 8102 Gene: SYNW0359: Metallothionein	Synechocystis sp. PCC 6803	* Thermosynechococcus elongatus BP-1 Site: position = -79 score = 5.94937 sequence = GACGTATGAACAGTTGTTCAAGTATA Gene: tsl1016 (deprecated): Metallothionein	Trichodesmium erythraeum IMS101	Metallothionein

CRON 3.
ziaA	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 7425	Cyanothece sp. PCC 8801	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab	Synechococcus sp. PCC 7002	Synechococcus sp. WH 8102	* Synechocystis sp. PCC 6803 Site: position = -80 score = 6.52555 sequence = AATATCTGAGCATATCTTCAGGTGTT Gene: slr0798: Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101	Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)

CRON 4.
alr7622	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 7425	Cyanothece sp. PCC 8801	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	* Nostoc sp. PCC 7120 Site: position = 13 score = 6.43055 sequence = TACAATTGAATAGTTGTTCAATTGTT Gene: alr7622 (deprecated): Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab	Synechococcus sp. PCC 7002	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SmtB - Cyanobacteria

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --