Regulon of SmtB in Thermosynechococcus elongatus BP-1

Properties
Regulator type:	Transcription factor
TF locus tag:	tlr1018
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -79 Score: 5.9 Sequence: GACGTATGAACAGTTGTTCAAGTATA Locus tag: tsl1016 (deprecated) Name: smtA Funciton: Metallothionein
	tsl1016 (deprecated)	smtA	Metallothionein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD