Regulon of SmtB in Synechocystis sp. PCC 6803

Properties
Regulator type:	Transcription factor
TF locus tag:	sll0792
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 6.5 Sequence: AACACCTGAAGATATGCTCAGATATT Locus tag: sll0792 Name: smtB Funciton: Zinc stress transcriptional regulator, ArsR family
	sll0792	smtB	Zinc stress transcriptional regulator, ArsR family
Position: -80 Score: 6.5 Sequence: AATATCTGAGCATATCTTCAGGTGTT Locus tag: slr0798 Name: ziaA Funciton: Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)
	slr0798	ziaA	Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD