Regulon of SmtB in Synechococcus sp. PCC 7002

Properties
Regulator type:	Transcription factor
TF locus tag:	SYNPCC7002_A2564
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 7.2 Sequence: AATACCTGAATAATTGTTCATGTGTT Position: -53 Score: 6.2 Sequence: AAAATGTGAACAATCGTTCAACTATT Locus tag: SYNPCC7002_A2563 Name: smtA Funciton: Metallothionein
	SYNPCC7002_A2563	smtA	Metallothionein
Position: -75 Score: 6.2 Sequence: AATAGTTGAACGATTGTTCACATTTT Position: -43 Score: 7.2 Sequence: AACACATGAACAATTATTCAGGTATT Locus tag: SYNPCC7002_A2564 Name: smtB Funciton: Zinc stress transcriptional regulator, ArsR family
	SYNPCC7002_A2564	smtB	Zinc stress transcriptional regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD