Regulon of SmtB in Synechococcus elongatus PCC 7942

Properties
Regulator type:	Transcription factor
TF locus tag:	Synpcc7942_1291
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6.3 Sequence: CATACCTGAATCAAGATTCAGATGTT Position: -42 Score: 7.1 Sequence: AACACATGAACAGTTATTCAGATATT Locus tag: Synpcc7942_1290 Name: smtA Funciton: Metallothionein
	Synpcc7942_1290	smtA	Metallothionein
Position: -84 Score: 7.1 Sequence: AATATCTGAATAACTGTTCATGTGTT Position: -52 Score: 6.3 Sequence: AACATCTGAATCTTGATTCAGGTATG Locus tag: Synpcc7942_1291 Name: smtB Funciton: Zinc stress transcriptional regulator, ArsR family
	Synpcc7942_1291	smtB	Zinc stress transcriptional regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD