Regulog YybR/YdeP - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - HxlR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | 3 | 3 |
| Bacillus cereus ATCC 14579 | 2 | 2 |
| Bacillus clausii KSM-K16 | 2 | 2 |
| Bacillus halodurans C-125 | 2 | 2 |
| Bacillus licheniformis DSM 13 | 2 | 2 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | 5 | 5 |
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | 3 | 2 |
| Paenibacillus sp. JDR-2 | 2 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BC3390 |
|
|
Gene: BC3390: Nitroreductase family protein |
*
Bacillus clausii KSM-K16 Site: position = -177 score = 4.89546 sequence = CAGTTTCTTTTTATATACTA Site: position = -103 score = 5.62354 sequence = TAGTTTCTTTTATTATACTA Gene: ABC0785: Nitroreductase family protein |
|
|
|
|
|
|
|
Nitroreductase family protein |
| CRON 2. | ||||||||||||
| BH0738 |
|
|
|
Gene: ABC0750: Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase) |
*
Bacillus halodurans C-125 Site: position = -101 score = 5.16591 sequence = TAGTAACCTACATGTAACTA Gene: BH0738: Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase) |
|
Gene: BPUM_0783: Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase) |
|
|
|
|
Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase) |
| CRON 3. | ||||||||||||
| ppaC |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -193 score = 5.96763 sequence = TAGTACCTTTTTTGATACTA Gene: RBAM_037630: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Gene: BC2826: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Gene: ABC2903: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
|
|
Gene: BPUM_3708: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -190 score = 5.96763 sequence = TAGTACCTTTTTTGATACTA Gene: BSU40550: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
|
Gene: OB1018: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Gene: Pjdr2_2048: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
| CRON 4. | ||||||||||||
| yybR |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -33 score = 5.96763 sequence = TAGTATCAAAAAAGGTACTA Gene: RBAM_037620: Transcriptional regulator, HxlR family |
*
Bacillus cereus ATCC 14579 Site: position = -42 score = 6.26811 sequence = TAGTATCAAAAAAGATACTA Gene: BC3320: Transcriptional regulator, HxlR family |
*
Bacillus clausii KSM-K16 Site: position = -103 score = 5.62354 sequence = TAGTATAATAAAAGAAACTA Gene: ABC0784: Transcriptional regulator, HxlR family |
*
Bacillus halodurans C-125 Site: position = -49 score = 5.16591 sequence = TAGTTACATGTAGGTTACTA Gene: BH0737: Transcriptional regulator, HxlR family |
*
Bacillus licheniformis DSM 13 Site: position = -33 score = 6.31707 sequence = TAGTATCATTTTTTATACTA Gene: BLi00812: Transcriptional regulator, HxlR family |
Gene: BPUM_3162: Transcriptional regulator, HxlR family |
*2
Bacillus subtilis subsp. subtilis str. 168 Site: position = -34 score = 5.96763 sequence = TAGTATCAAAAAAGGTACTA Gene: BSU40540: Transcriptional regulator, HxlR family Site: position = -35 score = 6.18055 sequence = TAGTATCAAAAAGTATACTA Gene: BSU05290: Transcriptional regulator, HxlR family |
|
*
Oceanobacillus iheyensis HTE831 Site: position = -45 score = 5.61318 sequence = TAGTTTCCTTAAAGATACTA Gene: OB0354: Transcriptional regulator, HxlR family |
*
Paenibacillus sp. JDR-2 Site: position = -72 score = 5.97303 sequence = TAGTATTAAAAAGGATACTA Gene: Pjdr2_4452: Transcriptional regulator, HxlR family |
Transcriptional regulator, HxlR family |
| CRON 5. | ||||||||||||
| RBAM_017530 |
|
Gene: RBAM_017530: Putative oxidoreductase |
Gene: BC1937: Putative oxidoreductase |
|
|
|
|
|
|
*
Oceanobacillus iheyensis HTE831 Site: position = -123 score = 5.61318 sequence = TAGTATCTTTAAGGAAACTA Gene: OB0355: Putative oxidoreductase |
Gene: Pjdr2_2014: Putative oxidoreductase |
Putative oxidoreductase |
| OB0356 |
|
|
|
|
|
|
|
|
|
Gene: OB0356: FMN reductase (EC 1.5.1.29) |
|
FMN reductase (EC 1.5.1.29) |
| CRON 6. | ||||||||||||
| yfkO |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -100 score = 5.45533 sequence = CAGTATCAAAATGAATACTA Gene: RBAM_008000: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
*
Bacillus cereus ATCC 14579 Site: position = -107 score = 6.26811 sequence = TAGTATCTTTTTTGATACTA Gene: BC3321: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
|
Gene: BH0405: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
*
Bacillus licheniformis DSM 13 Site: position = -117 score = 6.31707 sequence = TAGTATAAAAAATGATACTA Gene: BLi00813: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
Gene: BPUM_3161: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -103 score = 5.96078 sequence = TGGTATCAAAATTGATACTA Gene: BSU07830: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
|
Gene: OB3126: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
*2
Paenibacillus sp. JDR-2 Gene: Pjdr2_4584: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) Site: position = -145 score = 5.97303 sequence = TAGTATCCTTTTTAATACTA Gene: Pjdr2_4453: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
| CRON 7. | ||||||||||||
| ydeQ |
|
|
|
|
|
|
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -95 score = 6.18055 sequence = TAGTATACTTTTTGATACTA Gene: BSU05300: Putative NAD(P)H oxidoreductase |
|
|
|
Putative NAD(P)H oxidoreductase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |