Regulon of YybR/YdeP in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB0354
Regulator family:	HxlR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	YybR/YdeP - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - HxlR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 5.6 Sequence: TAGTATCTTTAAGGAAACTA Locus tag: OB0355 Name: null Funciton: Putative oxidoreductase Locus tag: OB0356 Name: null Funciton: FMN reductase (EC 1.5.1.29)
	OB0355		Putative oxidoreductase
	OB0356		FMN reductase (EC 1.5.1.29)
Position: -45 Score: 5.6 Sequence: TAGTTTCCTTAAAGATACTA Locus tag: OB0354 Name: yybR Funciton: Transcriptional regulator, HxlR family
	OB0354	yybR	Transcriptional regulator, HxlR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD