Regulon of YybR/YdeP in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC0784
Regulator family:	HxlR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	YybR/YdeP - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - HxlR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 4.9 Sequence: CAGTTTCTTTTTATATACTA Position: -103 Score: 5.6 Sequence: TAGTTTCTTTTATTATACTA Locus tag: ABC0785 Name: null Funciton: Nitroreductase family protein
	ABC0785		Nitroreductase family protein
Position: -103 Score: 5.6 Sequence: TAGTATAATAAAAGAAACTA Locus tag: ABC0784 Name: yybR Funciton: Transcriptional regulator, HxlR family
	ABC0784	yybR	Transcriptional regulator, HxlR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD