Regulon of YybR/YdeP in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU40540, BSU05290
Regulator family:	HxlR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	YybR/YdeP - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - HxlR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.2 Sequence: TAGTATCAAAAAGTATACTA Locus tag: BSU05290 Name: ydeP Funciton: Transcriptional regulator, HxlR family
	BSU05290	ydeP	Transcriptional regulator, HxlR family
Position: -34 Score: 6 Sequence: TAGTATCAAAAAAGGTACTA Locus tag: BSU40540 Name: yybR Funciton: Transcriptional regulator, HxlR family
	BSU40540	yybR	Transcriptional regulator, HxlR family
Position: -95 Score: 6.2 Sequence: TAGTATACTTTTTGATACTA Locus tag: BSU05300 Name: ydeQ Funciton: Putative NAD(P)H oxidoreductase
	BSU05300	ydeQ	Putative NAD(P)H oxidoreductase
Position: -190 Score: 6 Sequence: TAGTACCTTTTTTGATACTA Locus tag: BSU40550 Name: ppaC Funciton: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
	BSU40550	ppaC	Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
Position: -103 Score: 6 Sequence: TGGTATCAAAATTGATACTA Locus tag: BSU07830 Name: yfkO Funciton: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34)
	BSU07830	yfkO	Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD