Regulon of YybR/YdeP in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_4452
Regulator family:	HxlR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	YybR/YdeP - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - HxlR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6 Sequence: TAGTATTAAAAAGGATACTA Locus tag: Pjdr2_4452 Name: yybR Funciton: Transcriptional regulator, HxlR family
	Pjdr2_4452	yybR	Transcriptional regulator, HxlR family
Position: -145 Score: 6 Sequence: TAGTATCCTTTTTAATACTA Locus tag: Pjdr2_4453 Name: yfkO Funciton: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34)
	Pjdr2_4453	yfkO	Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD