Regulon of YybR/YdeP in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH0737
Regulator family:	HxlR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	YybR/YdeP - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - HxlR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.2 Sequence: TAGTTACATGTAGGTTACTA Locus tag: BH0737 Name: yybR Funciton: Transcriptional regulator, HxlR family
	BH0737	yybR	Transcriptional regulator, HxlR family
Position: -101 Score: 5.2 Sequence: TAGTAACCTACATGTAACTA Locus tag: BH0738 Name: BH0738 Funciton: Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase)
	BH0738	BH0738	Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD