Regulog SmtB - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Heavy metal resistance |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
- By pathway - Heavy metal resistance
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | 1 | 1 |
| Desulfovibrio vulgaris str. Miyazaki F | 1 | 1 |
| Desulfovibrio desulfuricans G20 | 1 | 1 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 2 | 1 |
| Desulfovibrio magneticus RS-1 | ||
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | 2 | 1 |
| Desulfohalobium retbaense DSM 5692 | 2 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| smtB |
Gene: DVU2788: Transcriptional regulator, ArsR family |
Gene: DvMF_1207: Transcriptional regulator, ArsR family |
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -42 score = 6.71489 sequence = TATATGAACAGTTGTTCATATA Gene: Desal_1113: Transcriptional regulator, ArsR family |
|
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -64 score = 5.6412 sequence = TACTTGAACAACTATTCAAGCG Gene: Dbac_1470: Transcriptional regulator, ArsR family |
*
Desulfohalobium retbaense DSM 5692 Site: position = -47 score = 5.65441 sequence = TAATTGAACAATTGATCAAGCG Gene: Dret_2262: Transcriptional regulator, ArsR family |
Transcriptional regulator, ArsR family |
| DVU3386 |
*
Desulfovibrio vulgaris Hildenborough Site: position = -19 score = 6.22273 sequence = CGCATGAACAGATGTTCATATG Gene: DVU3386: permease, putative |
|
*
Desulfovibrio desulfuricans G20 Site: position = -61 score = 6.39747 sequence = CATATGAACGATTGCTCATATG Site: position = -45 score = 5.6514 sequence = CATATGTATGTTTGTTCATAAA Gene: Dde_0132: permease, putative |
|
|
Gene: Desal_1112: permease, putative |
|
|
Gene: Dbac_1469: permease, putative |
|
permease, putative |
| Dret_2261 |
|
|
|
|
|
|
|
|
|
Gene: Dret_2261: heavy metal translocating P-type ATPase |
heavy metal translocating P-type ATPase |
| CRON 2. | |||||||||||
| DvMF_2066 |
|
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -89 score = 6.48656 sequence = CATATGAACACGTGTTCATATG Gene: DvMF_2066: heavy metal translocating P-type ATPase |
|
|
|
|
|
|
|
|
heavy metal translocating P-type ATPase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |