Regulon of SmtB in Desulfovibrio vulgaris str. Miyazaki F
Regulator type: | Transcription factor |
TF locus tag: | DvMF_1207 |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Heavy metal resistance |
Effector: | |
Regulog: | SmtB - Desulfovibrionales |
Statistics of regulated genes: | |
- Genes | 1 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
- By pathway - Heavy metal resistance
Locus Tag | Name | Function | |
---|---|---|---|
Position: -89
Score: 6.5 Sequence: CATATGAACACGTGTTCATATG
Locus tag: DvMF_2066
Name: null Funciton: heavy metal translocating P-type ATPase |
|||
heavy metal translocating P-type ATPase
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |