Regulon of SmtB in Desulfohalobium retbaense DSM 5692
| Regulator type: | Transcription factor |
| TF locus tag: | Dret_2262 |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Heavy metal resistance |
| Effector: | |
| Regulog: | SmtB - Desulfovibrionales |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
- By pathway - Heavy metal resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -47
Score: 5.7 Sequence: TAATTGAACAATTGATCAAGCG
Locus tag: Dret_2262
Name: smtB Funciton: Transcriptional regulator, ArsR family
Locus tag: Dret_2261
Name: null Funciton: heavy metal translocating P-type ATPase |
|||
|
smtB
|
Transcriptional regulator, ArsR family
|
||
|
heavy metal translocating P-type ATPase
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |