Regulon of SmtB in Desulfohalobium retbaense DSM 5692

Properties
Regulator type:	Transcription factor
TF locus tag:	Dret_2262
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heavy metal resistance
Effector:
Regulog:	SmtB - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.7 Sequence: TAATTGAACAATTGATCAAGCG Locus tag: Dret_2262 Name: smtB Funciton: Transcriptional regulator, ArsR family Locus tag: Dret_2261 Name: null Funciton: heavy metal translocating P-type ATPase
	Dret_2262	smtB	Transcriptional regulator, ArsR family
	Dret_2261		heavy metal translocating P-type ATPase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD