Regulon of SmtB in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_0747
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heavy metal resistance
Effector:
Regulog:	SmtB - Desulfovibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.4 Sequence: CATATGAACGATTGCTCATATG Position: -45 Score: 5.7 Sequence: CATATGTATGTTTGTTCATAAA Locus tag: Dde_0132 Name: null Funciton: permease, putative
	Dde_0132		permease, putative

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD