Regulog YiaJ - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor |
| Biological process: | L-lyxose utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - IclR
- By effector - Ascorbate-6-phosphate
- By pathway - L-lyxose utilization
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 10 | 2 |
| Salmonella typhimurium LT2 | 11 | 2 |
| Citrobacter koseri ATCC BAA-895 | 6 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | 8 | 2 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| yiaJ |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -151 score = 6.32152 sequence = ATGCGAAACTTGATTTCAAAT Gene: b3574: transcriptional regulator of L-lyxose catabolism, IclR family |
*
Salmonella typhimurium LT2 Site: position = -168 score = 6.19118 sequence = ATGCGAAATCTAGTTCCAAAT Gene: STM3667: transcriptional regulator of L-lyxose catabolism, IclR family |
*
Citrobacter koseri ATCC BAA-895 Site: position = -167 score = 6.54484 sequence = ATGCGAAATCTGATTTCAAAT Gene: CKO_05032: transcriptional regulator of L-lyxose catabolism, IclR family |
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -287 score = 6.1361 sequence = ATGCGAAATTCAATTTCAAAA Gene: Spro_3928: transcriptional regulator of L-lyxose catabolism, IclR family |
|
|
|
|
transcriptional regulator of L-lyxose catabolism, IclR family |
| CRON 2. | |||||||||||||
| yiaK |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -70 score = 6.36801 sequence = ATTTGAAATCAAGTTTCGCAT Gene: b3575: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent |
*
Salmonella typhimurium LT2 Site: position = -82 score = 6.02193 sequence = ATTTGGAACTAGATTTCGCAT Gene: STM3668: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent |
*
Citrobacter koseri ATCC BAA-895 Site: position = -72 score = 6.54484 sequence = ATTTGAAATCAGATTTCGCAT Gene: CKO_05033: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent |
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -74 score = 6.09968 sequence = ATTTGAAATGCAATTCCGCAT Gene: Spro_3933: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent |
|
|
|
|
2,3-diketo-L-gulonate dehydrogenase, NADH-dependent |
| yiaL |
Gene: b3576: hypothetical protein |
Gene: STM3669: hypothetical protein |
Gene: CKO_05034: hypothetical protein |
|
|
|
|
Gene: Spro_3934: hypothetical protein |
|
|
|
|
hypothetical protein |
| cheX |
|
Gene: STM3670: putative chemotaxis protein |
Gene: CKO_05035: putative chemotaxis protein |
|
|
|
|
|
|
|
|
|
putative chemotaxis protein |
| yiaM |
Gene: b3577: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit |
Gene: STM3671: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit |
|
|
|
|
|
|
|
|
|
|
predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit |
| yiaN |
Gene: b3578: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit |
Gene: STM3672: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit |
|
|
|
|
|
|
|
|
|
|
predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit |
| yiaO |
Gene: b3579: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein |
Gene: STM3673: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein |
|
|
|
|
|
|
|
|
|
|
predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein |
| lyxK |
Gene: b3580: L-xylulose kinase |
Gene: STM3674: L-xylulose kinase |
Gene: CKO_05037: L-xylulose kinase |
|
|
|
|
Gene: Spro_3936: L-xylulose kinase |
|
|
|
|
L-xylulose kinase |
| sgbH |
Gene: b3581: 3-keto-L-gulonate 6-phosphate decarboxylase |
Gene: STM3675: 3-keto-L-gulonate 6-phosphate decarboxylase |
Gene: CKO_05039: 3-keto-L-gulonate 6-phosphate decarboxylase |
|
|
|
|
Gene: Spro_3937: 3-keto-L-gulonate 6-phosphate decarboxylase |
|
|
|
|
3-keto-L-gulonate 6-phosphate decarboxylase |
| sgbU |
Gene: b3582: putative 3-hexulose-6-phosphate isomerase |
Gene: STM3676: putative 3-hexulose-6-phosphate isomerase |
Gene: CKO_05040: putative 3-hexulose-6-phosphate isomerase |
|
|
|
|
Gene: Spro_3938: putative 3-hexulose-6-phosphate isomerase |
|
|
|
|
putative 3-hexulose-6-phosphate isomerase |
| sgbE |
Gene: b3583: L-ribulose-5-phosphate 4-epimerase |
Gene: STM3677: L-ribulose-5-phosphate 4-epimerase |
Gene: CKO_05041: L-ribulose-5-phosphate 4-epimerase |
|
|
|
|
Gene: Spro_3939: L-ribulose-5-phosphate 4-epimerase |
|
|
|
|
L-ribulose-5-phosphate 4-epimerase |
| sgbT |
|
|
Gene: CKO_05036: predicted 3-dehydro-L-gulonate MFS transporter |
|
|
|
|
Gene: Spro_3935: predicted 3-dehydro-L-gulonate MFS transporter |
|
|
|
|
predicted 3-dehydro-L-gulonate MFS transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |