Regulon of YiaJ in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM3667
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	L-lyxose utilization
Effector:	Ascorbate-6-phosphate
Regulog:	YiaJ - Enterobacteriales
Statistics of regulated genes:
- Genes	11
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - IclR
By effector - Ascorbate-6-phosphate
By pathway - L-lyxose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 6 Sequence: ATTTGGAACTAGATTTCGCAT Locus tag: STM3668 Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent Locus tag: STM3669 Name: yiaL Funciton: hypothetical protein Locus tag: STM3670 Name: cheX Funciton: putative chemotaxis protein Locus tag: STM3671 Name: yiaM Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit Locus tag: STM3672 Name: yiaN Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit Locus tag: STM3673 Name: yiaO Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein Locus tag: STM3674 Name: lyxK Funciton: L-xylulose kinase Locus tag: STM3675 Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase Locus tag: STM3676 Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase Locus tag: STM3677 Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase
	STM3668	yiaK	2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
	STM3669	yiaL	hypothetical protein
	STM3670	cheX	putative chemotaxis protein
	STM3671	yiaM	predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
	STM3672	yiaN	predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
	STM3673	yiaO	predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
	STM3674	lyxK	L-xylulose kinase
	STM3675	sgbH	3-keto-L-gulonate 6-phosphate decarboxylase
	STM3676	sgbU	putative 3-hexulose-6-phosphate isomerase
	STM3677	sgbE	L-ribulose-5-phosphate 4-epimerase
Position: -168 Score: 6.2 Sequence: ATGCGAAATCTAGTTCCAAAT Locus tag: STM3667 Name: yiaJ Funciton: transcriptional regulator of L-lyxose catabolism, IclR family
	STM3667	yiaJ	transcriptional regulator of L-lyxose catabolism, IclR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD