Regulon of YiaJ in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_3928
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	L-lyxose utilization
Effector:	Ascorbate-6-phosphate
Regulog:	YiaJ - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - IclR
By effector - Ascorbate-6-phosphate
By pathway - L-lyxose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6.1 Sequence: ATTTGAAATGCAATTCCGCAT Locus tag: Spro_3933 Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent Locus tag: Spro_3934 Name: yiaL Funciton: hypothetical protein Locus tag: Spro_3935 Name: sgbT Funciton: predicted 3-dehydro-L-gulonate MFS transporter Locus tag: Spro_3936 Name: lyxK Funciton: L-xylulose kinase Locus tag: Spro_3937 Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase Locus tag: Spro_3938 Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase Locus tag: Spro_3939 Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase
	Spro_3933	yiaK	2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
	Spro_3934	yiaL	hypothetical protein
	Spro_3935	sgbT	predicted 3-dehydro-L-gulonate MFS transporter
	Spro_3936	lyxK	L-xylulose kinase
	Spro_3937	sgbH	3-keto-L-gulonate 6-phosphate decarboxylase
	Spro_3938	sgbU	putative 3-hexulose-6-phosphate isomerase
	Spro_3939	sgbE	L-ribulose-5-phosphate 4-epimerase
Position: -287 Score: 6.1 Sequence: ATGCGAAATTCAATTTCAAAA Locus tag: Spro_3928 Name: yiaJ Funciton: transcriptional regulator of L-lyxose catabolism, IclR family
	Spro_3928	yiaJ	transcriptional regulator of L-lyxose catabolism, IclR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD