Regulon of YiaJ in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b3574
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	L-lyxose utilization
Effector:	Ascorbate-6-phosphate
Regulog:	YiaJ - Enterobacteriales
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - IclR
By effector - Ascorbate-6-phosphate
By pathway - L-lyxose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.4 Sequence: ATTTGAAATCAAGTTTCGCAT Locus tag: b3575 Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent Locus tag: b3576 Name: yiaL Funciton: hypothetical protein Locus tag: b3577 Name: yiaM Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit Locus tag: b3578 Name: yiaN Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit Locus tag: b3579 Name: yiaO Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein Locus tag: b3580 Name: lyxK Funciton: L-xylulose kinase Locus tag: b3581 Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase Locus tag: b3582 Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase Locus tag: b3583 Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase
	b3575	yiaK	2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
	b3576	yiaL	hypothetical protein
	b3577	yiaM	predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
	b3578	yiaN	predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
	b3579	yiaO	predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
	b3580	lyxK	L-xylulose kinase
	b3581	sgbH	3-keto-L-gulonate 6-phosphate decarboxylase
	b3582	sgbU	putative 3-hexulose-6-phosphate isomerase
	b3583	sgbE	L-ribulose-5-phosphate 4-epimerase
Position: -151 Score: 6.3 Sequence: ATGCGAAACTTGATTTCAAAT Locus tag: b3574 Name: yiaJ Funciton: transcriptional regulator of L-lyxose catabolism, IclR family
	b3574	yiaJ	transcriptional regulator of L-lyxose catabolism, IclR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD