Regulon of YiaJ in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_05032
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	L-lyxose utilization
Effector:	Ascorbate-6-phosphate
Regulog:	YiaJ - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - IclR
By effector - Ascorbate-6-phosphate
By pathway - L-lyxose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.5 Sequence: ATTTGAAATCAGATTTCGCAT Locus tag: CKO_05033 Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent Locus tag: CKO_05034 Name: yiaL Funciton: hypothetical protein Locus tag: CKO_05035 Name: cheX Funciton: putative chemotaxis protein Locus tag: CKO_05036 Name: sgbT Funciton: predicted 3-dehydro-L-gulonate MFS transporter Locus tag: CKO_05037 Name: lyxK Funciton: L-xylulose kinase
	CKO_05033	yiaK	2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
	CKO_05034	yiaL	hypothetical protein
	CKO_05035	cheX	putative chemotaxis protein
	CKO_05036	sgbT	predicted 3-dehydro-L-gulonate MFS transporter
	CKO_05037	lyxK	L-xylulose kinase
Position: -167 Score: 6.5 Sequence: ATGCGAAATCTGATTTCAAAT Locus tag: CKO_05032 Name: yiaJ Funciton: transcriptional regulator of L-lyxose catabolism, IclR family
	CKO_05032	yiaJ	transcriptional regulator of L-lyxose catabolism, IclR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD