Regulon of XylR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_0357
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose; Glucose
Regulog:	XylR - Thermotogales
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Xylose
By effector - Glucose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -183 Score: 5.2 Sequence: AATTTTTCGGGGAAAGAAATAAT Locus tag: Tlet_0358 Name: xylF Funciton: Xylose ABC transporter, permease component Locus tag: Tlet_0359 Name: xylE Funciton: Xylose ABC transporter, substrate-binding component Locus tag: Tlet_0360 Name: xylK Funciton: Xylose ABC transporter, ATP-binding component Locus tag: Tlet_0361 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	Tlet_0358	xylF	Xylose ABC transporter, permease component
	Tlet_0359	xylE	Xylose ABC transporter, substrate-binding component
	Tlet_0360	xylK	Xylose ABC transporter, ATP-binding component
	Tlet_0361	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -52 Score: 5.2 Sequence: AATTTTTCGAGGAAATAAATAAT Locus tag: Tlet_0350 Name: xloE Funciton: Xylose oligosaccharides ABC transporter, sugar-binding protein Locus tag: Tlet_0351 Name: xloF Funciton: Xylose oligosaccharides ABC transporter, permease protein 1 Locus tag: Tlet_0352 Name: xloG Funciton: Xylose oligosaccharides ABC transporter, permease protein 2 Locus tag: Tlet_0353 Name: xloK Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 1 Locus tag: Tlet_0354 Name: xloL Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 2 Locus tag: Tlet_0355 Name: xyl3 Funciton: Beta-xylosidase (EC 3.2.1.37) Locus tag: Tlet_0356 Name: axeA Funciton: Acetyl xylan esterase (EC 3.1.1.41) Locus tag: Tlet_0357 Name: xylR Funciton: Xylose-responsive transcription regulator, ROK family
	Tlet_0350	xloE	Xylose oligosaccharides ABC transporter, sugar-binding protein
	Tlet_0351	xloF	Xylose oligosaccharides ABC transporter, permease protein 1
	Tlet_0352	xloG	Xylose oligosaccharides ABC transporter, permease protein 2
	Tlet_0353	xloK	Xylose oligosaccharides ABC transporter, ATP-binding protein 1
	Tlet_0354	xloL	Xylose oligosaccharides ABC transporter, ATP-binding protein 2
	Tlet_0355	xyl3	Beta-xylosidase (EC 3.2.1.37)
	Tlet_0356	axeA	Acetyl xylan esterase (EC 3.1.1.41)
	Tlet_0357	xylR	Xylose-responsive transcription regulator, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD