Regulon of XylR in Thermotoga petrophila RKU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Tpet_0814
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose; Glucose
Regulog:	XylR - Thermotogales
Statistics of regulated genes:
- Genes	27
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Xylose
By effector - Glucose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 4.9 Sequence: GAAAGTTCTTTAGAGGAAAAAAT Locus tag: Tpet_0608 Name: xtpN Funciton: Predicted xylose oligosaccharide ABC transporter, substrate-binding component Locus tag: Tpet_0607 Name: bgaL Funciton: Beta-galactosidase (EC 3.2.1.23)
	Tpet_0608	xtpN	Predicted xylose oligosaccharide ABC transporter, substrate-binding component
	Tpet_0607	bgaL	Beta-galactosidase (EC 3.2.1.23)
Position: -61 Score: 5.2 Sequence: ATTATTTCCCGCATATAATTAAT Locus tag: Tpet_0814 Name: xylR Funciton: Xylose-responsive transcription regulator, ROK family Locus tag: Tpet_0813 Name: adhB Funciton: Iron-containing alcohol dehydrogenase Locus tag: Tpet_0812 Name: xylF Funciton: Xylose ABC transporter, permease component Locus tag: Tpet_0811 Name: xylU Funciton: Acetyl xylan esterase XylU (EC 3.1.1.41) Locus tag: Tpet_0810 Name: xylE Funciton: Xylose ABC transporter, substrate-binding component Locus tag: Tpet_0809 Name: xylK Funciton: Xylose ABC transporter, ATP-binding component Locus tag: Tpet_0808 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	Tpet_0814	xylR	Xylose-responsive transcription regulator, ROK family
	Tpet_0813	adhB	Iron-containing alcohol dehydrogenase
	Tpet_0812	xylF	Xylose ABC transporter, permease component
	Tpet_0811	xylU	Acetyl xylan esterase XylU (EC 3.1.1.41)
	Tpet_0810	xylE	Xylose ABC transporter, substrate-binding component
	Tpet_0809	xylK	Xylose ABC transporter, ATP-binding component
	Tpet_0808	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -38 Score: 5 Sequence: ATAATTGATTGATAGAAAAAATT Locus tag: Tpet_1124 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: Tpet_1123 Name: TM1668 Funciton: conserved hypothetical protein
	Tpet_1124	xylA	Xylose isomerase (EC 5.3.1.5)
	Tpet_1123	TM1668	conserved hypothetical protein
Position: -54 Score: 5.4 Sequence: AATATTTCCCGAAAGGAAAAAAA Locus tag: Tpet_0853 Name: xloE Funciton: Xylose oligosaccharides ABC transporter, sugar-binding protein Locus tag: Tpet_0852 Name: xloF Funciton: Xylose oligosaccharides ABC transporter, permease protein 1 Locus tag: Tpet_0851 Name: xloG Funciton: Xylose oligosaccharides ABC transporter, permease protein 2 Locus tag: Tpet_0850 Name: xloK Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 1 Locus tag: Tpet_0849 Name: xloL Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 2 Locus tag: Tpet_0848 Name: xyl3 Funciton: Beta-xylosidase (EC 3.2.1.37) Locus tag: Tpet_0847 Name: axeA Funciton: Acetyl xylan esterase (EC 3.1.1.41)
	Tpet_0853	xloE	Xylose oligosaccharides ABC transporter, sugar-binding protein
	Tpet_0852	xloF	Xylose oligosaccharides ABC transporter, permease protein 1
	Tpet_0851	xloG	Xylose oligosaccharides ABC transporter, permease protein 2
	Tpet_0850	xloK	Xylose oligosaccharides ABC transporter, ATP-binding protein 1
	Tpet_0849	xloL	Xylose oligosaccharides ABC transporter, ATP-binding protein 2
	Tpet_0848	xyl3	Beta-xylosidase (EC 3.2.1.37)
	Tpet_0847	axeA	Acetyl xylan esterase (EC 3.1.1.41)
Position: -189 Score: 5.4 Sequence: TTTTTTTCCTTTCGGGAAATATT Locus tag: Tpet_0854 Name: xynB Funciton: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
	Tpet_0854	xynB	Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
Position: -87 Score: 5.8 Sequence: ATTTTTTCTTTACAAAAAATAAC Locus tag: Tpet_0863 Name: xynA1 Funciton: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8) Locus tag: Tpet_0862 Name: cenC Funciton: Carbohydrate-binding, CenC domain protein
	Tpet_0863	xynA1	Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
	Tpet_0862	cenC	Carbohydrate-binding, CenC domain protein
Position: -255 Score: 5.8 Sequence: GTTATTTTTTGTAAAGAAAAAAT Locus tag: Tpet_0864 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: Tpet_0865 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: Tpet_0866 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: Tpet_0867 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: Tpet_0868 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: Tpet_0869 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
	Tpet_0864	xtpF	Xylan oligosaccharide ABC transporter, permease component 1
	Tpet_0865	xtpG	Xylan oligosaccharide ABC transporter, permease component 2
	Tpet_0866	xtpK	Xylan oligosaccharide ABC transporter, ATP-binding protein 1
	Tpet_0867	xtpL	Xylan oligosaccharide ABC transporter, ATP-binding protein 2
	Tpet_0868	xtpE	Xylan oligosaccharide ABC transporter, substrate-binding component
	Tpet_0869	aguA	Alpha-glucuronidase (EC 3.2.1.139)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of XylR in Thermotoga petrophila RKU-1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --