Regulon of XylR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_0581
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose; Glucose
Regulog:	XylR - Thermotogales
Statistics of regulated genes:
- Genes	26
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Xylose
By effector - Glucose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 4.3 Sequence: AaaATTgtTTGgtAgaAAAaAAg Locus tag: CTN_0379 Name: xtpN Funciton: Predicted xylose oligosaccharide ABC transporter, substrate-binding component Locus tag: CTN_0378 Name: xtpN Funciton: Predicted xylose oligosaccharide ABC transporter, substrate-binding component Locus tag: CTN_0377 Name: bgaL Funciton: Beta-galactosidase (EC 3.2.1.23)
	CTN_0379	xtpN	Predicted xylose oligosaccharide ABC transporter, substrate-binding component
	CTN_0378	xtpN	Predicted xylose oligosaccharide ABC transporter, substrate-binding component
	CTN_0377	bgaL	Beta-galactosidase (EC 3.2.1.23)
Position: -41 Score: 5.2 Sequence: GTTTTTTCCTTTCTGAAAATAAC Locus tag: CTN_1302 Name: xynA3 Funciton: Endo-1,4-beta-xylanase C precursor (EC 3.2.1.8)
	CTN_1302	xynA3	Endo-1,4-beta-xylanase C precursor (EC 3.2.1.8)
Position: -38 Score: 5 Sequence: ATAATTGATTGATAGAAAAAATT Locus tag: CTN_0720 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: CTN_0719 Name: TM1668 Funciton: conserved hypothetical protein
	CTN_0720	xylA	Xylose isomerase (EC 5.3.1.5)
	CTN_0719	TM1668	conserved hypothetical protein
Position: -34 Score: 5.1 Sequence: ATTAATTCCTGCATATAATTAAT Locus tag: CTN_0581 Name: xylR Funciton: Xylose-responsive transcription regulator, ROK family Locus tag: CTN_0580 Name: adhB Funciton: Iron-containing alcohol dehydrogenase Locus tag: CTN_0578 Name: xylF Funciton: Xylose ABC transporter, permease component
	CTN_0581	xylR	Xylose-responsive transcription regulator, ROK family
	CTN_0580	adhB	Iron-containing alcohol dehydrogenase
	CTN_0578	xylF	Xylose ABC transporter, permease component
Position: -52 Score: 5.8 Sequence: AATATTTCCCGAAAGGAAAAAAT Locus tag: CTN_0622 Name: xloE Funciton: Xylose oligosaccharides ABC transporter, sugar-binding protein Locus tag: CTN_0621 Name: xloF Funciton: Xylose oligosaccharides ABC transporter, permease protein 1 Locus tag: CTN_0620 Name: xloG Funciton: Xylose oligosaccharides ABC transporter, permease protein 2 Locus tag: CTN_0619 Name: xloK Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 1 Locus tag: CTN_0618 Name: xloL Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 2 Locus tag: CTN_0617 Name: null Funciton: Endo-1,3-beta-xylanase Locus tag: CTN_0616 Name: xyl3 Funciton: Beta-xylosidase (EC 3.2.1.37) Locus tag: CTN_0615 Name: axeA Funciton: Acetyl xylan esterase (EC 3.1.1.41)
	CTN_0622	xloE	Xylose oligosaccharides ABC transporter, sugar-binding protein
	CTN_0621	xloF	Xylose oligosaccharides ABC transporter, permease protein 1
	CTN_0620	xloG	Xylose oligosaccharides ABC transporter, permease protein 2
	CTN_0619	xloK	Xylose oligosaccharides ABC transporter, ATP-binding protein 1
	CTN_0618	xloL	Xylose oligosaccharides ABC transporter, ATP-binding protein 2
	CTN_0617		Endo-1,3-beta-xylanase
	CTN_0616	xyl3	Beta-xylosidase (EC 3.2.1.37)
	CTN_0615	axeA	Acetyl xylan esterase (EC 3.1.1.41)
Position: -190 Score: 5.8 Sequence: ATTTTTTCCTTTCGGGAAATATT Locus tag: CTN_0623 Name: xynB Funciton: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
	CTN_0623	xynB	Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
Position: -41 Score: 5.3 Sequence: ATTTTTTCTCCGTAAGAAATAAC Locus tag: CTN_0632 Name: xynA1 Funciton: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
	CTN_0632	xynA1	Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
Position: -245 Score: 5.3 Sequence: GTTATTTCTTACGGAGAAAAAAT Locus tag: CTN_0633 Name: null Funciton: Transposase, IS605 OrfB family Locus tag: CTN_0634 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: CTN_0635 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: CTN_0636 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: CTN_0637 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: CTN_0638 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: CTN_0639 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
	CTN_0633		Transposase, IS605 OrfB family
	CTN_0634	xtpF	Xylan oligosaccharide ABC transporter, permease component 1
	CTN_0635	xtpG	Xylan oligosaccharide ABC transporter, permease component 2
	CTN_0636	xtpK	Xylan oligosaccharide ABC transporter, ATP-binding protein 1
	CTN_0637	xtpL	Xylan oligosaccharide ABC transporter, ATP-binding protein 2
	CTN_0638	xtpE	Xylan oligosaccharide ABC transporter, substrate-binding component
	CTN_0639	aguA	Alpha-glucuronidase (EC 3.2.1.139)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of XylR in Thermotoga neapolitana DSM 4359

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --