Regulon of XylR in Thermotoga sp. RQ2

Properties
Regulator type:	Transcription factor
TF locus tag:	TRQ2_0837
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose; Glucose
Regulog:	XylR - Thermotogales
Statistics of regulated genes:
- Genes	27
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Xylose
By effector - Glucose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.4 Sequence: GAAATTTCTTTAGAGGAAAAAAT Locus tag: TRQ2_0622 Name: xtpN Funciton: Predicted xylose oligosaccharide ABC transporter, substrate-binding component Locus tag: TRQ2_0621 Name: bgaL Funciton: Beta-galactosidase (EC 3.2.1.23)
	TRQ2_0622	xtpN	Predicted xylose oligosaccharide ABC transporter, substrate-binding component
	TRQ2_0621	bgaL	Beta-galactosidase (EC 3.2.1.23)
Position: -40 Score: 5.2 Sequence: GTTTTTTCCTTTCTGAAAATAAC Locus tag: TRQ2_1549 Name: xynA3 Funciton: Endo-1,4-beta-xylanase C precursor (EC 3.2.1.8)
	TRQ2_1549	xynA3	Endo-1,4-beta-xylanase C precursor (EC 3.2.1.8)
Position: -38 Score: 5 Sequence: ATAATTGATTGATAGAAAAAATT Locus tag: TRQ2_1162 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: TRQ2_1161 Name: TM1668 Funciton: conserved hypothetical protein
	TRQ2_1162	xylA	Xylose isomerase (EC 5.3.1.5)
	TRQ2_1161	TM1668	conserved hypothetical protein
Position: -61 Score: 5.2 Sequence: ATTATTTCCCGCATATAATTAAT Locus tag: TRQ2_0837 Name: xylR Funciton: Xylose-responsive transcription regulator, ROK family Locus tag: TRQ2_0836 Name: adhB Funciton: Iron-containing alcohol dehydrogenase Locus tag: TRQ2_0835 Name: xylF Funciton: Xylose ABC transporter, permease component Locus tag: TRQ2_0834 Name: xylU Funciton: Acetyl xylan esterase XylU (EC 3.1.1.41) Locus tag: TRQ2_0833 Name: xylE Funciton: Xylose ABC transporter, substrate-binding component Locus tag: TRQ2_0832 Name: xylK Funciton: Xylose ABC transporter, ATP-binding component Locus tag: TRQ2_0831 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	TRQ2_0837	xylR	Xylose-responsive transcription regulator, ROK family
	TRQ2_0836	adhB	Iron-containing alcohol dehydrogenase
	TRQ2_0835	xylF	Xylose ABC transporter, permease component
	TRQ2_0834	xylU	Acetyl xylan esterase XylU (EC 3.1.1.41)
	TRQ2_0833	xylE	Xylose ABC transporter, substrate-binding component
	TRQ2_0832	xylK	Xylose ABC transporter, ATP-binding component
	TRQ2_0831	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -53 Score: 5.8 Sequence: AATATTTCCCGAAAGGAAAAAAT Locus tag: TRQ2_0876 Name: xloE Funciton: Xylose oligosaccharides ABC transporter, sugar-binding protein Locus tag: TRQ2_0875 Name: xloF Funciton: Xylose oligosaccharides ABC transporter, permease protein 1 Locus tag: TRQ2_0874 Name: xloG Funciton: Xylose oligosaccharides ABC transporter, permease protein 2 Locus tag: TRQ2_0873 Name: xloK Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 1 Locus tag: TRQ2_0872 Name: xloL Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 2 Locus tag: TRQ2_0871 Name: xyl3 Funciton: Beta-xylosidase (EC 3.2.1.37) Locus tag: TRQ2_0870 Name: axeA Funciton: Acetyl xylan esterase (EC 3.1.1.41)
	TRQ2_0876	xloE	Xylose oligosaccharides ABC transporter, sugar-binding protein
	TRQ2_0875	xloF	Xylose oligosaccharides ABC transporter, permease protein 1
	TRQ2_0874	xloG	Xylose oligosaccharides ABC transporter, permease protein 2
	TRQ2_0873	xloK	Xylose oligosaccharides ABC transporter, ATP-binding protein 1
	TRQ2_0872	xloL	Xylose oligosaccharides ABC transporter, ATP-binding protein 2
	TRQ2_0871	xyl3	Beta-xylosidase (EC 3.2.1.37)
	TRQ2_0870	axeA	Acetyl xylan esterase (EC 3.1.1.41)
Position: -189 Score: 5.8 Sequence: ATTTTTTCCTTTCGGGAAATATT Locus tag: TRQ2_0877 Name: xynB Funciton: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
	TRQ2_0877	xynB	Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
Position: -87 Score: 5.8 Sequence: ATTTTTTCTTTACAAAAAATAAC Locus tag: TRQ2_0885 Name: xynA1 Funciton: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
	TRQ2_0885	xynA1	Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
Position: -254 Score: 5.8 Sequence: GTTATTTTTTGTAAAGAAAAAAT Locus tag: TRQ2_0886 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: TRQ2_0887 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: TRQ2_0888 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: TRQ2_0889 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: TRQ2_0890 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: TRQ2_0891 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
	TRQ2_0886	xtpF	Xylan oligosaccharide ABC transporter, permease component 1
	TRQ2_0887	xtpG	Xylan oligosaccharide ABC transporter, permease component 2
	TRQ2_0888	xtpK	Xylan oligosaccharide ABC transporter, ATP-binding protein 1
	TRQ2_0889	xtpL	Xylan oligosaccharide ABC transporter, ATP-binding protein 2
	TRQ2_0890	xtpE	Xylan oligosaccharide ABC transporter, substrate-binding component
	TRQ2_0891	aguA	Alpha-glucuronidase (EC 3.2.1.139)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of XylR in Thermotoga sp. RQ2

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --