Regulon of XylR in Thermotoga maritima MSB8

Properties
Regulator type:	Transcription factor
TF locus tag:	TM0110
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose; Glucose
Regulog:	XylR - Thermotogales
Statistics of regulated genes:
- Genes	27
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Xylose
By effector - Glucose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.4 Sequence: GAAATTTCTTTAGAGGAAAAAAT Locus tag: TM0309 Name: xtpN Funciton: Predicted xylose oligosaccharide ABC transporter, substrate-binding component Locus tag: TM0310 Name: bgaL Funciton: Beta-galactosidase (EC 3.2.1.23)
	TM0309	xtpN	Predicted xylose oligosaccharide ABC transporter, substrate-binding component
	TM0310	bgaL	Beta-galactosidase (EC 3.2.1.23)
Position: -38 Score: 5 Sequence: ATAATTGATTGATAGAAAAAATT Locus tag: TM1667 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: TM1668 Name: TM1668 Funciton: conserved hypothetical protein
	TM1667	xylA	Xylose isomerase (EC 5.3.1.5)
	TM1668	TM1668	conserved hypothetical protein
Position: -61 Score: 5.4 Sequence: ATTATTTCCTGCATATAATTAAT Locus tag: TM0110 Name: xylR Funciton: Xylose-responsive transcription regulator, ROK family Locus tag: TM0111 Name: adhB Funciton: Iron-containing alcohol dehydrogenase Locus tag: TM0112 Name: xylF Funciton: Xylose ABC transporter, permease component Locus tag: TM0113 Name: xylU Funciton: Acetyl xylan esterase XylU (EC 3.1.1.41) Locus tag: TM0114 Name: xylE Funciton: Xylose ABC transporter, substrate-binding component Locus tag: TM0115 Name: xylK Funciton: Xylose ABC transporter, ATP-binding component Locus tag: TM0116 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	TM0110	xylR	Xylose-responsive transcription regulator, ROK family
	TM0111	adhB	Iron-containing alcohol dehydrogenase
	TM0112	xylF	Xylose ABC transporter, permease component
	TM0113	xylU	Acetyl xylan esterase XylU (EC 3.1.1.41)
	TM0114	xylE	Xylose ABC transporter, substrate-binding component
	TM0115	xylK	Xylose ABC transporter, ATP-binding component
	TM0116	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -254 Score: 5.8 Sequence: GTTATTTTTTGTAAAGAAAAAAT Locus tag: TM0060 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: TM0059 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: TM0058 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: TM0057 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: TM0056 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: TM0055 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
	TM0060	xtpF	Xylan oligosaccharide ABC transporter, permease component 1
	TM0059	xtpG	Xylan oligosaccharide ABC transporter, permease component 2
	TM0058	xtpK	Xylan oligosaccharide ABC transporter, ATP-binding protein 1
	TM0057	xtpL	Xylan oligosaccharide ABC transporter, ATP-binding protein 2
	TM0056	xtpE	Xylan oligosaccharide ABC transporter, substrate-binding component
	TM0055	aguA	Alpha-glucuronidase (EC 3.2.1.139)
Position: -189 Score: 5.8 Sequence: ATTTTTTCCTTTCGGGAAATATT Locus tag: TM0070 Name: xynB Funciton: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
	TM0070	xynB	Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
Position: -87 Score: 5.8 Sequence: ATTTTTTCTTTACAAAAAATAAC Locus tag: TM0061 Name: xynA1 Funciton: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8) Locus tag: TM0062 Name: cenC Funciton: Carbohydrate-binding, CenC domain protein
	TM0061	xynA1	Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
	TM0062	cenC	Carbohydrate-binding, CenC domain protein
Position: -53 Score: 5.8 Sequence: AATATTTCCCGAAAGGAAAAAAT Locus tag: TM0071 Name: xloE Funciton: Xylose oligosaccharides ABC transporter, sugar-binding protein Locus tag: TM0072 Name: xloF Funciton: Xylose oligosaccharides ABC transporter, permease protein 1 Locus tag: TM0073 Name: xloG Funciton: Xylose oligosaccharides ABC transporter, permease protein 2 Locus tag: TM0074 Name: xloK Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 1 Locus tag: TM0075 Name: xloL Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 2 Locus tag: TM0076 Name: xyl3 Funciton: Beta-xylosidase (EC 3.2.1.37) Locus tag: TM0077 Name: axeA Funciton: Acetyl xylan esterase (EC 3.1.1.41)
	TM0071	xloE	Xylose oligosaccharides ABC transporter, sugar-binding protein
	TM0072	xloF	Xylose oligosaccharides ABC transporter, permease protein 1
	TM0073	xloG	Xylose oligosaccharides ABC transporter, permease protein 2
	TM0074	xloK	Xylose oligosaccharides ABC transporter, ATP-binding protein 1
	TM0075	xloL	Xylose oligosaccharides ABC transporter, ATP-binding protein 2
	TM0076	xyl3	Beta-xylosidase (EC 3.2.1.37)
	TM0077	axeA	Acetyl xylan esterase (EC 3.1.1.41)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of XylR in Thermotoga maritima MSB8

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --